CHKL (CHKB) (NM_152253) Human Untagged Clone

SKU
SC109066
CHKB (untagged)-Human choline kinase beta (CHKB), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CHKL
Synonyms CHETK; CHKL; choline/ethanolamine kinase; choline kinase-like; choline kinase beta; CKEKB; EKB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109066 sequence for NM_152253 edited (data generated by NextGen Sequencing)
ATGGCGGCCGAGGCGACAGCTGTGGCCGGAAGCGGGGCTGTTGGCGGCTGCCTGGCCAAA
GACGGCTTGCAGCAGTCTAAGTGCCCGGACACTACCCCAAAACGGCGGCGCGCCTCGTCG
CTGTCGCGTGACGCCGAGCGCCGAGCCTACCAATGGTGCCGGGAGTACTTGGGCGGGGCC
TGGCGCCGAGTGCAGCCCGAGGAGCTGAGGGTTTACCCCGTGAGGTGGGAGGTCAGGGGT
CAGCCTCTCCGGTGCGCGGATCGGGGTCAGGGGTCAGCCGCGGGGCCCTCAGGATGCTCC
ATGTTTTCGCCCCCCTCTTGCGCCCGCGCCTGGGGCGGGGCGGGGCCGGCCTGGCCGGGA
GGGGGCCGGGGCCGCGGCAGGTAG

Clone variation with respect to NM_152253.1
5' Read Nucleotide Sequence
>OriGene 5' read for NM_152253 unedited
TTGGATTATGTAACACGATCTTATATAGGCGGCCGCGCAATTCGCACCAGGNAAAAAGCC
CCCGGGCCGGGGCACGGAGAGAGCCGAGCGCCGCAGCCGTGAGCCGAATAGAGCCGGAGA
GACCCGAGTATGACCGGAGAAGCCCAGGCCGGCCGGAAGAGGAGCCGAGCGCGGCCGGAA
GGAACCGAGCCCGTCCGAAGGGAGCGGAGCGCAGCCTGGCCTGGGGCCCGGTCGAGCCCG
CGCCATGGCGGCCGAGGCGACAGCTGTGGCCGGAAGCGGGGCTGTTGGCGGCTGCCTGGC
CAAAGACGGCTTGCAGCAGTCTAAGTGCCCGGACACTACCCCAAAACGGCGGCGCGCCTC
GTCGCTGTCGCGTGACGCCGAGCGCCGAGCCTACCAATGGTGCCGGGAGTACTTGGGCGG
GGCCTGGCGCCGAGTGCAGCCCGAGGAGCTGAGGGTTTACCCCGTGAGGTGGGAGGTCAG
GGGTCAGCCTCTCCGGTGCGCGGATCGGGGTCAGGGGTCAGCCGCGGGGCCCTCAGGATG
CTCCATGTTTTCGCCCCCCTCTTGCGCCCGCGCCTGGGGCGGGGCGGGGCCGGCCTGGCC
GGGAGGGGGCCGGGGCCGCGGCAGGTAGGGCCGGCCGCGGGCTGAGCGCGCCTGGTGTGG
GTCTGCAGCGGGAGCCTCAGCAACCTGCTCTTCCGCTGCTCGCTCCCGGACCACCTGCCC
AGCGTTGGCGAGGAGCCCCGGGAGGTGCTTCTGCNGCTGTACGGAGCCATCTTGCANNGT
GAGGGGTTGTGAGCGCCGCAGCACCAGTGGCTTTAGGGCCTGTCGCTTACGCGATGCGGG
TAGTATTGGTCCCGTTGCGCAGTTGAGGACACCGAGTTCACGGTCTGAGTAACACTCATT
ACACGAAGGCTGGGGCTGTATCCCAGAGCTTTNGGAGCTGNAGGAGAGGATCACTG
Restriction Sites NotI-NotI
ACCN NM_152253
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152253.1, NP_689466.1
RefSeq Size 4914 bp
RefSeq ORF 384 bp
Locus ID 1120
Cytogenetics 22q13.33
Domains Carn_acyltransf
Protein Families Druggable Genome
Protein Pathways Glycerophospholipid metabolism, Metabolic pathways
Summary Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (2) contains alternate segments in the coding region which causes a frameshift, compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct C-terminus than isoform a. In addition, this variant is bicistronic, with the coding region of a carnitine palmitoyltransferase gene present in the 3' end of the transcript.
Write Your Own Review
You're reviewing:CHKL (CHKB) (NM_152253) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222406 CHKB (Myc-DDK-tagged)-Human choline kinase beta (CHKB), transcript variant 2 10 ug
$289.00
RC222406L3 Lenti-ORF clone of CHKB (Myc-DDK-tagged)-Human choline kinase beta (CHKB), transcript variant 2 10 ug
$450.00
RC222406L4 Lenti-ORF clone of CHKB (mGFP-tagged)-Human choline kinase beta (CHKB), transcript variant 2 10 ug
$450.00
RG222406 CHKB (tGFP-tagged) - Human choline kinase beta (CHKB), transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.