CDK2 (NM_001798) Human Untagged Clone

CAT#: SC109060

CDK2 (untagged)-Human cyclin-dependent kinase 2 (CDK2), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDK2 (NM_001798) Human Untagged Clone
Symbol CDK2
Synonyms CDKN2; p33(CDK2)
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001798 edited
CGGCCGCGAATTCGGCACGAGGCAACATTGTTTCAAGTTGGCCAAATTGACAAGAGCGAG
AGGTATACTGCGTTCCATCCCGACCCGGGGCCACGGTACTGGGCCCTGTTTCCCCCTCCT
CGGCCCCCGAGAGCCAGGGTCCGCCTTCTGCAGGGTTCCCAGGCCCCCGCTCCAGGGCCG
GGCTGACCCGACTCGCTGGCGCTTCATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGA
GGGCACGTACGGAGTTGTGTACAAAGCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCT
TAAGAAAATCCGCCTGGACACTGAGACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGAT
CTCTCTGCTTAAGGAGCTTAACCATCCTAATATTGTCAAGCTGCTGGATGTCATTCACAC
AGAAAATAAACTCTACCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGA
TGCCTCTGCTCTCACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCT
CCAGGGCCTAGCTTTCTGCCATTCTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAA
TCTGCTTATTAACACAGAGGGGGCCATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTT
TGGAGTCCCTGTTCGTACTTACACCCATGAGGTGGTGACCCTGTGGTACCGAGCTCCTGA
AATCCTCCTGGGCTGCAAATATTATTCCACAGCTGTGGACATCTGGAGCCTGGGCTGCAT
CTTTGCTGAGATGGTGACTCGCCGGGCCCTATTCCCTGGAGATTCTGAGATTGACCAGCT
CTTCCGGATCTTTCGGACTCTGGGGACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTC
TATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGT
ACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAA
CAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCC
AGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCAGCCCTAATCTCACCCTCT
CCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCTATTTGGACTCAGGTGGGCCCTCT
GAACTTGCCTTAAACACTCACCTTCTAGTCTTGGCCAGCCAACTCTGGGAATACAGGGGT
GAAAGGGGGGGAACCAGTGAAAATGAAAGGAAGTTTCAGTATTAGATGCACTTAAGTTAG
CCTCCA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001798 unedited
TGTAATACGACTCACTATAGGGNNNCGGCCGCGAATTCGGCACGAGGCAACATTGTTTCA
AGTTGGCCAAATTGACAAGAGCGAGAGGTATACTGCGTTCCATCCCGACCCGGGGCCACG
GTACTGGGCCCTGTTTCCCCCTCCTCGGCCCCCGAGAGCCAGGGTCCGCCTTCTGCAGGG
TTCCCAGGCCCCCGCTCCAGGGCCGGGCTGACCCGACTCGCTGGCGCTTCATGGAGAACT
TCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAACA
AGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAGACTGAGGGTG
TGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGACGCTTAACCATCCTAATATT
GTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACCTGGTTTTTGAATTTCTG
CACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCTCTTCCCCTC
ATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCTNCATCGGTC
CTCCACCGAGACCTTANACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGCTA
GCAGACTTTGGACTAACCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACCCATGAGGTG
GTGACCCTGTGGTCCCGAGCNTCCTGAAATCCTCCTGGGCTGNCAATATTATCCCACAGC
TTGTGGACATCTTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTTCGCCGCCCCTA
TTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGTATCTTCNGACTCTGGNGACCCAN
ATGAGGTGGTGTGGCCAGNAATACTCNATGNCTGATACAGCCAGTTTCCCAGTGGCCCGC
AG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001798 unedited
TGCCATTTTTTTAAGATTTACAAACTAAATTACAAATAACGTTAATAGCAAGAGCACTCA
AGTACAGGGTGACAGAGACAAATTATAAAAAAAAAAGCCCTTTTTTCTTTAGTACTGCCA
TTACAAAATCTCAATGTGCACATGGTAACAAATCCACCCACTATGACCAAAAAAAAAAAA
AAAATCTAACTTTACTATTGGATATAACCCCAAATATCAATACAATCGCCTATGCTCCCT
TTAAACAAATATTCCCACCCTGCCCTCTCTCTCTCCCCATCTTCAAAAATCGCCATTATT
CTTTACAATGATGCTCAACTTTTACTTTTAACTTTCTATGGCGTCTCTCTTCTTTCCTCC
TTTTCTTTTTTTCTCCTTTCCCTTTCCCCCTTTTCCCCCCTTCCATCTTTTCCCCCCCCT
TTTTCCCCCTTCCCCCTTTCCCCCCTCCCCTCCCCCCCCTTTTCCCTTTTTCCCCATCCA
TTTTTTCCCCCATTTCCCCCCCCTTTTATTTTCCCTTTTCTTCCCTTCATTTCCCCCCCT
CCTTTTTCCATTTCCCTCCTCTTCCCTTTTTTCCCTTCCCTCCCCCCTCCCCCTTTTCTT
TTCCCCTTCTTTCCCCCCCCCCCCCTTTCCCTCCCCCCCCCCTCCCCCTTTTTCTTCCCC
CCCTTTCCCCCCCCCTTCCTACTTATCCTTATTTTTTCCTTCCCCCATCCCCCCCCCCCC
TTTTTTCCACCTTTTTCTCTCCCCCCCCCCCCTTTTTCCCCCCCCCCCTCTCCGCTTTCC
CTTCCCTTTCTCCCCCTTTCCCCTCCCTTTCTTTTCACCCCATTCCCCTACCCCTCTCTC
TTCCTTTTTTCCTTATTCTCCCCCCACCCTTTTCTTTTTTTTTTACTCCCTCCCCTGTCC
CCCCCTTTTCTTTCTTCCCCCCTGTTTCTTTATCCCCCCCCTATTCCCCTCTTCCCTTTT
CCCGCTCACCCTTTCCN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001798
ORF Size 897 bp
Insert Size 2190
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001798.2, NP_001789
RefSeq Size 2328
RefSeq ORF 897
Locus ID 1017
Cytogenetics 12q13.2
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, p53 signaling pathway, Progesterone-mediated oocyte maturation, Pathways in cancer, Prostate cancer, Small cell lung cancer
Gene Summary This gene encodes a member of a family of serine/threonine protein kinases that participate in cell cycle regulation. The encoded protein is the catalytic subunit of the cyclin-dependent protein kinase complex, which regulates progression through the cell cycle. Activity of this protein is especially critical during the G1 to S phase transition. This protein associates with and regulated by other subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A), and p27Kip1 (CDKN1B). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.