GRP78 (HSPA5) (NM_005347) Human Untagged Clone

CAT#: SC108086

Reviews ()
Write a review

HSPA5 (untagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5)



  "NM_005347" in other vectors (6)

USD 544.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSPA5
Synonyms BIP; GRP78; HEL-S-89n
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC108086 sequence for NM_005347 edited (data generated by NextGen Sequencing)
ATGAAGCTCTCCCTGGTGGCCGCGATGCTGCTGCTGCTCAGCGCGGCGCGGGCCGAGGAG
GAGGACAAGAAGGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCC
TGCGTCGGCGTGTTCAAGAACGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGC
ATCACGCCGTCCTATGTCGCCTTCACTCCTGAAGGGGAACGTCTGATTGGCGATGCCGCC
AAGAACCAGCTCACCTCCAACCCCGAGAACACGGTCTTTGACGCCAAGCGGCTCATCGGC
CGCACGTGGAATGACCCGTCTGTGCAGCAGGACATCAAGTTCTTGCCGTTCAAGGTGGTT
GAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGGCAAACAAAGACATTT
GCTCCTGAAGAAATTTCTGCCATGGTTCTCACTAAAATGAAAGAAACCGCTGAGGCTTAT
TTGGGAAAGAAGGTTACCCATGCAGTTGTTACTGTACCAGCCTATTTTAATGATGCCCAA
CGCCAAGCAACCAAAGACGCTGGAACTATTGCTGGCCTAAATGTTATGAGGATCATCAAC
GAGCCTACGGCAGCTGCTATTGCTTATGGCCTGGATAAGAGGGAGGGGGAGAAGAACATC
CTGGTGTTTGACCTGGGTGGCGGAACCTTCGATGTGTCTCTTCTCACCATTGACAATGGT
GTCTTCGAAGTTGTGGCCACTAATGGAGATACTCATCTGGGTGGAGAAGACTTTGACCAG
CGTGTCATGGAACACTTCATCAAACTGTACAAAAAGAAGACGGGCAAAGATGTCAGGAAA
GACAATAGAGCTGTGCAGAAACTCCGGCGCGAGGTAGAAAAGGCCAAACGGGCCCTGTCT
TCTCAGCATCAAGCAAGAATTGAAATTGAGTCCTTCTATGAAGGAGAAGACTTTTCTGAG
ACCCTGACTCGGGCCAAATTTGAAGAGCTCAACATGGATCTGTTCCGGTCTACTATGAAG
CCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTT
CTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAAT
GGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTC
CAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGT
CCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAAC
ACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACT
GTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAAAGACAATCATCTTCTGGGT
ACATTTGATCTGACTGGAATTCCTCCTGCTCCTCGTGGGGTCCCACAGATTGAAGTCACC
TTTGAGATAGATGTGAATGGTATTCTTCGAGTGACAGCTGAAGACAAGGGTACAGGGAAC
AAAAATAAGATCACAATCACCAATGACCAGAATCGCCTGACACCTGAAGAAATCGAAAGG
ATGGTTAATGATGCTGAGAAGTTTGCTGAGGAAGACAAAAAGCTCAAGGAGCGCATTGAT
ACTAGAAATGAGTTGGAAAGCTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAA
AAGCTGGGAGGTAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCTGTAGAAGAA
AAGATTGAATGGCTGGAAAGCCACCAAGATGCTGACATTGAAGACTTCAAAGCTAAGAAG
AAGGAACTGGAAGAAATTGTTCAACCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCT
CCCCCAACTGGTGAAGAGGATACAGCAGAAAAAGATGAGTTGTAG

Clone variation with respect to NM_005347.4
Restriction Sites Please inquire     
ACCN NM_005347
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005347.2, NP_005338.1
RefSeq Size 3925 bp
RefSeq ORF 1965 bp
Locus ID 3309
UniProt ID P11021
Cytogenetics 9q33.3
Domains HSP70
Protein Families Druggable Genome
Protein Pathways Antigen processing and presentation, Prion diseases
Gene Summary The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. This protein localizes to the lumen of the endoplasmic reticulum (ER) where it operates as a typical HSP70 chaperone involved in the folding and assembly of proteins in the ER and is a master regulator of ER homeostasis. During cellular stress, as during viral infection or tumorogenesis, this protein interacts with the transmembrane stress sensor proteins PERK (protein kinase R-like endoplasmic reticulum kinase), IRE1 (inositol-requiring kinase 1), and ATF6 (activating transcription factor 6) where it acts as a repressor of the unfolded protein response (UPR) and also plays a role in cellular apoptosis and senescence. Elevated expression and atypical translocation of this protein to the cell surface has been reported in viral infections and some types of cancer cells. At the cell surface this protein may facilitate viral attachment and entry to host cells. This gene is a therapeutic target for the treatment of coronavirus diseases and chemoresistant cancers. [provided by RefSeq, Jul 2020]

Other Versions

Other products for "HSPA5"
Frequently bought together (4)
Rabbit polyclonal anti-GRP78 / HSPA5 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.