MYCBP (NM_012333) Human Untagged Clone

SKU
SC107923
MYCBP (untagged)-Human c-myc binding protein (MYCBP), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MYCBP
Synonyms AMY-1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_012333 edited
ATGGCCCATTACAAAGCCGCCGACTCGAAGCGTGAGCAGTTCCGGAGGTACTTGGAGAAG
TCGGGGGTGCTGGACACGCTGACCAAGGTGTTGGTAGCCTTATATGAAGAACCAGAGAAA
CCTAACAGTGCTTTGGATTTTTTAAAGCATCACTTAGGAGCTGCTACTCCAGAAAATCCA
GAAATAGAGCTGCTTCGCCTAGAACTGGCCGAAATGAAAGAGAAGTATGAAGCTATTGTA
GAAGAAAATAAAAAACTGAAAGCAAAGCTTGCTCAGTATGAACCACCTCAGGAGGAGAAG
CGTGCTGAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_012333 unedited
NTGCGGTTTTGTAACCGATTACTATAGGCGGCACGCGAATTCGCACCAGCCGGCGCCAGC
TACGCCGCTGCCGCTGTCACTATGGCCCATTACAAAGCCGCCGACTCGAAGCGTGAGCAG
TTCCGGAGGTACTTGGAGAAGTCGGGGGTGCTGGACACGCTGACCAAGGTGTTGGTAGCC
TTATATGAAGAACCAGAGAAACCTAACATTTCTTTGGATTTTTTAAAGCATCACTTAGGA
GCTGCTACTCCAGAAAATCCAGAAATAGAGCTGCTTCGCCTAGAACTGGCCGAAATGAAA
GAGAAGTATGAAGCTATTGTAGAAGAAAATAAAAAACTGAAAGCAAAGCTTGCTCAGTAT
GAACCACCTCAGGAGGAGAAGCGTGCTGAATAGGATTCTTCTCAGTTTGAAAGACAATGA
AAAATGGTTTTGTATGACTTGAATAGTTTGTATAGTATATAATCTTTTCTGAACAGATGC
TATAGAACTCTTTTAATATGTTTAATTCACCTATCACACTCTGTTAAAAACACATAGAAT
CATCAATAAAAACTCAATATAACTTTCTTTGGGTCTTAAAGCAGGAGAATCCAAAGTAAA
TCCTGAACAAAACCTAAACACAGCCATCTAACTCATTACCTTAAAAGACATTCTGTTTAT
TAGTCTGATTAGGAATGATGGCACTGGTTGTATTTTAGCCAAGACAGTTTAGCATGGAGC
TATTCTTGGNTGCAGTTCAGGATATGAACACAGGTACAGTCATTCTTTGAAGGTGACACT
GTTCTGTATATTCCCCTATAGCAGCTGGAGAGATCTGTGTGACACAAGATGCTTTTGTAC
GGGTTCCCATGAAATCTCTGCTCTTGGTNGTGTGACATGGAACANATACTTNCTTGNCAC
CACTTTGCCTTAGATACTGTGTGTGTGTGTGCCG
Restriction Sites NotI-NotI
ACCN NM_012333
Insert Size 2150 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012333.3, NP_036465.2
RefSeq Size 2093 bp
RefSeq ORF 312 bp
Locus ID 26292
UniProt ID Q99417
Cytogenetics 1p34.3
Protein Families ES Cell Differentiation/IPS, Transcription Factors
Summary The protein encoded by this gene binds to the N-terminus of the oncogenic protein C-MYC, enhancing the ability of C-MYC to activate E box-dependent transcription. The encoded protein is normally found in the cytoplasm, but it translocates to the nucleus during S phase of the cell cycle and associates with C-MYC. This protein may be involved in spermatogenesis. This gene can be silenced by microRNA-22. Two transcript variants, one protein-coding and the other probably not protein-coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the supported protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:MYCBP (NM_012333) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202238 MYCBP (Myc-DDK-tagged)-Human c-myc binding protein (MycBP), transcript variant 1 10 ug
$150.00
RC202238L1 Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC202238L2 Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, mGFP tagged 10 ug
$450.00
RC202238L3 Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC202238L4 Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, mGFP tagged 10 ug
$450.00
RG202238 MYCBP (tGFP-tagged) - Human c-myc binding protein (MYCBP), transcript variant 1 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.