MYCBP (NM_012333) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | MYCBP |
Synonyms | AMY-1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_012333 edited
ATGGCCCATTACAAAGCCGCCGACTCGAAGCGTGAGCAGTTCCGGAGGTACTTGGAGAAG TCGGGGGTGCTGGACACGCTGACCAAGGTGTTGGTAGCCTTATATGAAGAACCAGAGAAA CCTAACAGTGCTTTGGATTTTTTAAAGCATCACTTAGGAGCTGCTACTCCAGAAAATCCA GAAATAGAGCTGCTTCGCCTAGAACTGGCCGAAATGAAAGAGAAGTATGAAGCTATTGTA GAAGAAAATAAAAAACTGAAAGCAAAGCTTGCTCAGTATGAACCACCTCAGGAGGAGAAG CGTGCTGAATAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_012333 unedited
NTGCGGTTTTGTAACCGATTACTATAGGCGGCACGCGAATTCGCACCAGCCGGCGCCAGC TACGCCGCTGCCGCTGTCACTATGGCCCATTACAAAGCCGCCGACTCGAAGCGTGAGCAG TTCCGGAGGTACTTGGAGAAGTCGGGGGTGCTGGACACGCTGACCAAGGTGTTGGTAGCC TTATATGAAGAACCAGAGAAACCTAACATTTCTTTGGATTTTTTAAAGCATCACTTAGGA GCTGCTACTCCAGAAAATCCAGAAATAGAGCTGCTTCGCCTAGAACTGGCCGAAATGAAA GAGAAGTATGAAGCTATTGTAGAAGAAAATAAAAAACTGAAAGCAAAGCTTGCTCAGTAT GAACCACCTCAGGAGGAGAAGCGTGCTGAATAGGATTCTTCTCAGTTTGAAAGACAATGA AAAATGGTTTTGTATGACTTGAATAGTTTGTATAGTATATAATCTTTTCTGAACAGATGC TATAGAACTCTTTTAATATGTTTAATTCACCTATCACACTCTGTTAAAAACACATAGAAT CATCAATAAAAACTCAATATAACTTTCTTTGGGTCTTAAAGCAGGAGAATCCAAAGTAAA TCCTGAACAAAACCTAAACACAGCCATCTAACTCATTACCTTAAAAGACATTCTGTTTAT TAGTCTGATTAGGAATGATGGCACTGGTTGTATTTTAGCCAAGACAGTTTAGCATGGAGC TATTCTTGGNTGCAGTTCAGGATATGAACACAGGTACAGTCATTCTTTGAAGGTGACACT GTTCTGTATATTCCCCTATAGCAGCTGGAGAGATCTGTGTGACACAAGATGCTTTTGTAC GGGTTCCCATGAAATCTCTGCTCTTGGTNGTGTGACATGGAACANATACTTNCTTGNCAC CACTTTGCCTTAGATACTGTGTGTGTGTGTGCCG |
Restriction Sites | NotI-NotI |
ACCN | NM_012333 |
Insert Size | 2150 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_012333.3, NP_036465.2 |
RefSeq Size | 2093 bp |
RefSeq ORF | 312 bp |
Locus ID | 26292 |
UniProt ID | Q99417 |
Cytogenetics | 1p34.3 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
Summary | The protein encoded by this gene binds to the N-terminus of the oncogenic protein C-MYC, enhancing the ability of C-MYC to activate E box-dependent transcription. The encoded protein is normally found in the cytoplasm, but it translocates to the nucleus during S phase of the cell cycle and associates with C-MYC. This protein may be involved in spermatogenesis. This gene can be silenced by microRNA-22. Two transcript variants, one protein-coding and the other probably not protein-coding, have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the supported protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC202238 | MYCBP (Myc-DDK-tagged)-Human c-myc binding protein (MycBP), transcript variant 1 | 10 ug |
$150.00
|
|
RC202238L1 | Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202238L2 | Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
RC202238L3 | Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC202238L4 | Lenti ORF clone of Human c-myc binding protein (MYCBP), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
RG202238 | MYCBP (tGFP-tagged) - Human c-myc binding protein (MYCBP), transcript variant 1 | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.