UBE2D3 (NM_181889) Human Untagged Clone

SKU
SC107492
UBE2D3 (untagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 5
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBE2D3
Synonyms E2(17)KB3; UBC4/5; UBCH5C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC107492 representing NM_181889.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGAAACGGATTAATAAGGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATGTTCTGCA
GGTCCAGTTGGGGATGATATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCATATCAA
GGCGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTGCATTT
ACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGATCACAG
TGGTCGCCTGCTTTAACAATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAACCCA
GATGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATATCT
CGGGAATGGACTCAGAAGTATGCCATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_181889
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181889.1
RefSeq Size 3856 bp
RefSeq ORF 444 bp
Locus ID 7323
UniProt ID P61077
Cytogenetics 4q24
Protein Pathways Ubiquitin mediated proteolysis
MW 16.7 kDa
Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (5) has an alternate 5' UTR exon, and encodes the same isoform (1), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:UBE2D3 (NM_181889) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213686 UBE2D3 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 5 10 ug
$150.00
RC213686L3 Lenti-ORF clone of UBE2D3 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 5 10 ug
$450.00
RC213686L4 Lenti-ORF clone of UBE2D3 (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 5 10 ug
$450.00
RG213686 UBE2D3 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2D 3 (UBE2D3), transcript variant 5 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.