MTREX (NM_015360) Human Untagged Clone

CAT#: SC100442

Reviews ()
Write a review

SKIV2L2 (untagged)-Human superkiller viralicidic activity 2-like 2 (S. cerevisiae) (SKIV2L2)



  "NM_015360" in other vectors (4)

Reconstitution Protocol

USD 908.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "MTREX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MTREX
Synonyms Dob1; fSAP118; KIAA0052; Mtr4; SKIV2L2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_015360, the custom clone sequence may differ by one or more nucleotides


ATGGCGGACGCATTCGGAGATGAGCTGTTCAGCGTGTTCGAGGGCGACTCGACCACTGCGGCGGGAACCA
AAAAAGACAAGGAAAAGGACAAGGGGAAATGGAAGGGGCCTCCAGGGTCTGCAGACAAGGCAGGGAAACG
TTTTGATGGTAAATTACAATCAGAATCAACTAATAATGGAAAAAATAAGAGAGATGTAGATTTCGAAGGT
ACAGATGAACCCATTTTTGGAAAGAAGCCCAGGATAGAAGAGTCAATAACTGAAGACTTAAGTTTGGCAG
ACCTGATGCCCAGAGTCAAGGTACAATCAGTTGAAACTGTTGAAGGGTGTACACATGAGGTTGCACTTCC
TGCAGAAGAGGATTATTTACCACTTAAACCACGAGTTGGAAAAGCTGCTAAGGAATACCCGTTCATTCTT
GATGCTTTTCAAAGAGAGGCCATTCAGTGTGTTGACAATAATCAGTCTGTTCTAGTATCTGCACATACCT
CAGCGGGAAAAACAGTATGCGCCGAGTATGCCATTGCATTGGCCTTAAGGGAAAAGCAGCGTGTAATATT
TACCAGCCCAATTAAGGCTCTGAGTAACCAAAAATACCGTGAAATGTATGAAGAATTTCAAGATGTTGGT
TTGATGACTGGTGATGTTACTATTAATCCTACGGCATCTTGTCTTGTTATGACCACAGAGATTTTGAGAA
GTATGCTTTACAGAGGTTCCGAAGTTATGAGAGAAGTTGCTTGGGTTATATTTGATGAAATTCATTATAT
GAGAGATTCAGAACGTGGTGTAGTATGGGAAGAAACTATTATTTTGCTTCCTGATAACGTCCACTATGTC
TTTCTTTCGGCTACTATTCCAAATGCCCGACAGTTTGCTGAATGGATTTGCCATTTACATAAACAGCCTT
GTCATGTTATTTACACAGATTATCGGCCCACTCCATTGCAACACTACATTTTTCCAGCAGGGGGAGATGG
CCTGCATCTTGTGGTTGATGAAAATGGTGACTTCAGAGAAGATAATTTTAATACTGCAATGCAAGTGCTT
CGAGATGCAGGTGATTTGGCCAAAGGAGACCAGAAAGGGCGGAAAGGAGGAACAAAAGGACCATCAAATG
TTTTCAAAATTGTGAAGATGATTATGGAAAGAAATTTCCAACCTGTGATTATTTTCAGTTTTAGTAAGAA
AGATTGTGAAGCCTATGCACTTCAAATGACCAAATTAGATTTCAACACAGATGAAGAAAAGAAGATGGTT
GAAGAAGTATTCAGTAATGCAATTGATTGCTTATCCGATGAAGATAAAAAACTCCCTCAGGTAGAACATG
TACTTCCTCTTTTGAAGAGGGGAATTGGTATTCACCATGGTGGTTTACTTCCTATTTTGAAAGAAACTAT
AGAAATTCTCTTTTCTGAAGGATTGATAAAGGCCTTATTTGCCACGGAGACCTTTGCTATGGGAATTAAC
ATGCCAGCTAGAACTGTTTTATTTACAAATGCCCGCAAATTTGATGGGAAGGATTTCCGATGGATTTCTT
CTGGTGAATACATTCAGATGTCTGGTCGTGCTGGAAGGAGAGGAATGGATGATAGAGGAATTGTAATTCT
TATGGTAGATGAAAAGATGAGCCCAACAATTGGAAAACAATTACTTAAGGGCTCCGCTGATCCTCTAAAT
AGTGCTTTCCATTTGACCTACAACATGGTTTTGAACTTACTACGTGTAGAAGAAATTAATCCTGAGTACA
TGTTGGAAAAATCCTTCTACCAGTTTCAGCATTATAGAGCAATTCCAGGAGTAGTAGAGAAGGTAAAGAA
TTCAGAAGAACAGTATAATAAAATAGTAATTCCCAATGAAGAAAGTGTGGTTATCTATTATAAGATTAGA
CAGCAGCTTGCCAAATTGGGTAAAGAAATTGAAGAATATATTCACAAACCAAAATACTGCTTACCTTTTC
TACAACCAGGTCGTTTGGTAAAGGTAAAGAATGAAGGAGATGACTTTGGCTGGGGAGTAGTGGTGAATTT
CTCAAAAAAGTCAAATGTTAAGCCTAACTCTGGTGAACTGGATCCTTTGTATGTAGTAGAAGTACTTCTG
CGCTGTAGCAAAGAGAGCTTGAAAAATTCAGCTACAGAAGCTGCAAAACCAGCTAAACCTGATGAGAAAG
GAGAGATGCAGGTTGTCCCAGTTTTGGTGCATCTCCTGTCTGCTATCAGCAGTGTTAGGCTTTACATTCC
TAAAGACCTTCGGCCGGTGGACAATAGACAGAGTGTTTTAAAATCAATACAGGAAGTTCAGAAACGTTTT
CCTGACGGCATCCCCTTATTAGACCCTATTGATGATATGGGCATTCAAGATCAAGGGCTGAAAAAAGTCA
TTCAGAAAGTAGAAGCTTTTGAGCATCGAATGTATTCTCATCCACTTCACAATGATCCAAATTTGGAAAC
TGTGTATACGCTTTGTGAAAAAAAAGCACAGATTGCAATAGATATTAAATCTGCAAAGCGAGAACTGAAG
AAAGCAAGAACAGTCCTACAAATGGATGAACTCAAATGTCGCAAACGTGTTTTAAGAAGGTTGGGATTTG
CTACTTCTTCTGATGTAATAGAGATGAAAGGACGAGTGGCTTGTGAGATAAGCAGTGCTGATGAGCTCCT
TCTAACTGAGATGATGTTTAATGGCCTTTTCAATGACCTTTCTGCAGAACAGGCAACAGCATTATTAAGC
TGCTTTGTGTTTCAAGAGAATTCTAGTGAGATGCCCAAATTAACAGAACAATTAGCAGGACCACTTCGTC
AAATGCAGGAATGTGCTAAAAGAATTGCAAAAGTTTCAGCAGAAGCCAAATTGGAAATTGATGAGGAAAC
TTATCTAAGCTCATTTAAACCTCACTTAATGGATGTAGTATATACCTGGGCAACTGGAGCTACATTTGCC
CATATCTGCAAAATGACAGATGTCTTTGAAGGCAGCATAATTCGTTGTATGAGGCGCCTGGAAGAATTGC
TTCGACAAATGTGTCAAGCAGCAAAAGCCATTGGAAACACTGAGCTGGAAAATAAATTTGCAGAAGGAAT
CACCAAAATCAAGAGAGATATTGTGTTTGCTGCCAGCCTCTACTTGTAG


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites NotI-NotI     
ACCN NM_015360
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015360.2, NP_056175.2
RefSeq Size 4222 bp
RefSeq ORF 3129 bp
Locus ID 23517
UniProt ID P42285
Cytogenetics 5q11.2
Domains DEAD, helicase_C
Protein Pathways RNA degradation
Gene Summary Component of exosome targeting complexes. Subunit of the trimeric nuclear exosome targeting (NEXT) complex, a complex that directs a subset of non-coding short-lived RNAs for exosomal degradation. Subunit of the trimeric poly(A) tail exosome targeting (PAXT) complex, a complex that directs a subset of long and polyadenylated poly(A) RNAs for exosomal degradation. The RNA exosome is fundamental for the degradation of RNA in eukaryotic nuclei. Substrate targeting is facilitated by its cofactor MTREX, which links to RNA-binding protein adapters (PubMed:27871484). Associated with the RNA exosome complex and involved in the 3'-processing of the 7S pre-RNA to the mature 5.8S rRNA (PubMed:17412707, PubMed:29107693). May be involved in pre-mRNA splicing.[UniProtKB/Swiss-Prot Function]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.