Caly (NM_001190399) Rat Untagged Clone

SKU
RN216089
Caly (untagged) - Rat calcyon neuron-specific vesicular protein (Caly), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Caly
Synonyms Calcyon; Drd1ip
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN216089 representing NM_001190399
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAACTAGGCTGCAGCTTCTCAGGGAAGCCAGGCAAGGAAACAGGAGACCAGGATGGGGCTGCCA
TGGACAGTGTGCCTCTGATCAGCCCCCTGGATGTCAGCCAGCTTCAGCCATCATTCCCTGACCAGGTGGT
CATCAAAACACAGACAGAATATCAACTTACCTCTGCGGACCAGCCAAAGAAGTTCGCAGATTTGGAGGGT
CAGAGGCTGGCCTGCAGCCACCCAGAGGAAGGACGCAGACTGCCCACTGCAAGGATGATTGCCTTTGCTA
TGGCACTTCTGGGCTGTGTGCTGATCATGTACAAGGCCATTTGGTATGACCAGTTCACCTGCCCAGATGG
CTTCCTACTTCGGCACAAGATCTGCACCCCACTGACCCTGGAGATGTACTACACCGAGATGGACCCCGAA
CGCCACCGCAGCATCCTGGCAGCCATCGGGGCCTACCCACTGAGCCGCAAGCACGGCACTGAGATGCCCG
CCATCTGGGGAAACAGCTACCGGGCCGGCAAGGAGGAGCATAAGGGCACCACCCCAGCTGCGATGACTGT
GTCCACTGCAGCTGCAGCTGCAGCGGCAGAGGGCAACGAGCCGTCAGGGAAGCCTTTGGACATGAGAGAG
AAAGAAGATCCGCAGAAGGCGGAGGATGTGCCGTCCCAGTCCCCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001190399
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001190399.1, NP_001177328.1
RefSeq Size 991 bp
RefSeq ORF 681 bp
Locus ID 192349
UniProt ID P58821
Cytogenetics 1q41
Summary dopamine receptor 1 (D1R) of D1-like receptors interacting protein [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:Caly (NM_001190399) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR216089 Caly (myc-DDK-tagged) - Rat calcyon neuron-specific vesicular protein (Caly), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.