Obp3 (NM_147215) Rat Untagged Clone

SKU
RN215967
Obp3 (untagged) - Rat alpha-2u globulin PGCL4 (Obp3), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Obp3
Synonyms MGC108576
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN215967 representing NM_147215
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGTTGCTGCTGCTGCTGTGTCTGGGCCTGACCCTGGTCTGTGGCCATGCAGAAGAAGCTAGTT
TCGAGAGAGGGAACCTCGATGTGGACAAGCTCAATGGGGATTGGTTTTCTATTGTCGTGGCCTCTGATAA
AAGAGAAAAGATAGAAGAGAACGGCAGCATGAGAGTTTTTGTGCAGCATATCGATGTCTTGGAGAATTCC
TTAGGCTTCACGTTCCGTATTAAGGAAAATGGAGTGTGCACAGAATTTTCTTTGGTTGCCGACAAAACAG
CAAAGGATGGCGAATATTTTGTTGAGTATGACGGAGAGAATACATTTACTATACTTAAGACAGACTATGA
CAATTATGTCATGTTTCATCTCGTTAATGTCAACAACGGGGAAACCTTCCAGCTGATGGAGCTCTATGGC
AGAACAAAGGATCTGAGTTCAGACATCAAGGAAAAGTTTGCAAAACTATGTGTGGCACATGGAATCACTA
GGGACAATATCATTGACCTAACCAAGACTGATCGCTGTCTCCAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_147215
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_147215.2, NP_671748.2
RefSeq Size 1006 bp
RefSeq ORF 540 bp
Locus ID 259247
Cytogenetics 5q24
Summary odorant binding protein and member of the alpha(2u)-globulin family [RGD, Feb 2006]
Transcript Variant: The variant (1) represents the longest transcript. Variant 1, 2, and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:Obp3 (NM_147215) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR215967 Obp3 (myc-DDK-tagged) - Rat alpha-2u globulin PGCL4 (Obp3), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.