F11r (NM_053796) Rat Untagged Clone

SKU
RN208210
F11r (untagged ORF) - Rat F11 receptor (F11r), (10 ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol F11r
Synonyms Jam1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN208210 representing NM_053796
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCACCGAGGGGAAAGCCGGGAGCAAACTGTTGTTTCTCTTCACGTCTATGATCCTGGGCTCCTTGG
TGCAAGGCAAGGGTTCGGTGTACAGTCCTCAGACTGCCGTCCAGGTTCCTGAGAACGACTCTGTCAAGTT
GCCCTGTATCTACTCTGGCTTCTCCTCACCCCGCGTGGAGTGGAAGTTCGTCCAAGGCAGCACCACTGCG
CTTGTGTGCTATAACAACCAGATCACAGTTCCCTATGCAGACCGCGTCACCTTCTCATCCAGTGGCATCA
CCTTCAGCTCTGTGACCCGGAAAGACAATGGAGAGTATACTTGCATGGTCTCTGAGGACGGGGGTCAGAA
CTACGGGGAGGTCAGCATCCACCTCACTGTGCTTGTGCCTCCATCCAAGCCGACAGTCAGTATCCCCTCC
TCTGTCACCATTGGGAACAGGGCAGTGCTGACCTGCTCAGAACACGACGGTTCCCCTCCTTCTGAATATT
CCTGGTTCAAGGATGGGGTACCTATGCTTACAGCAGATGCCAAGAAAACCCGTGCCTTCATCAATTCTTC
ATACACCATCGATCCAAAGTCAGGGGATTTGGTCTTTGACCCTGTGTCAGCCTTTGATAGTGGCGAATAC
TACTGCGAGGCACAGAACGGGTATGGGACAGCCATGAGGTCAGAGGCTGTACGCATGGAGGCTGTGGAGC
TGAATGTGGGGGGCATCGTGGCAGCTGTCCTGGTAACACTGATTCTCCTTGGACTCCTGATTTTTGGCAT
CTGGTTTGCCTATAGCCGTGGATACTTTGAAAGAACAAAGAAAGGGACTGCACCGGGTAAGAAGGTCATT
TACAGCCAGCCCAGTGCTCGCAGTGAGGGAGAATTCAAACAGACCTCGTCATTCCTGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_053796
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_053796.1, NP_446248.1
RefSeq Size 1895 bp
RefSeq ORF 903 bp
Locus ID 116479
UniProt ID Q9JHY1
Cytogenetics 13q24
Summary Seems to play a role in epithelial tight junction formation. Appears early in primordial forms of cell junctions and recruits PARD3. The association of the PARD6-PARD3 complex may prevent the interaction of PARD3 with JAM1, thereby preventing tight junction assembly. Plays a role in regulating monocyte transmigration involved in integrity of epithelial barrier. Ligand for integrin alpha-L/beta-2 involved in memory T-cell and neutrophil transmigration.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:F11r (NM_053796) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR208210 F11r (Myc-DDK-tagged ORF) - Rat F11 receptor (F11r), (10 ug) 10 ug
$330.00
RR208210L3 Lenti ORF clone of F11r (Myc-DDK-tagged ORF) - Rat F11 receptor (F11r), (10 ug) 10 ug
$630.00
RR208210L4 Lenti ORF clone of F11r (mGFP-tagged ORF) - Rat F11 receptor (F11r), (10 ug) 10 ug
$630.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.