mrpl24 (NM_001007637) Rat Untagged Clone

SKU
RN207818
mrpl24 (untagged ORF) - Rat mitochondrial ribosomal protein L24 (mrpl24), nuclear gene encoding mitochondrial protein, (10 ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol mrpl24
Synonyms MGC94307
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN207818 representing NM_001007637
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGCTTTCAGCCTTGCTGGCCTTGGCATCCAAAGCCACTCTCTCCCCCCACTACCGCTATGGAATGA
GCCGTCCAGGTTCCATAGCAGACAAAAGGAAGAATCCTCCCTGGAGCAGGCGGCGCCCAGTAGTGGTAGA
GCCCATCTCTGATGAAGACTGGCACCTATTCTGTGGAGACATGGTGGAAATCTTAGAAGGCAAGGATGCT
GGGAAGCAGGGCAAAGTAGTCCAAGTTGTTCGGCAGCGGAACTGGGTTGTCCTGGAGGGATTGAACACGC
ATTACCGCTACATTGGCAGAACCAAGGATCACCGAGGGACCATGATCCCTAGCGAAGCCCCCTTGCTTCA
TCACCAAGTCAAGCTAGTGGATCCTGTGGACAGGAAACCTACTGAGATCCAGTGGAGATTTACTGAGGCA
GGAGAGCGTGTTCGTGTCTCTACAAGATCTGGGAGAATTATCCCCAAACCTGAATTTCCTAGAGCAGATG
GCATTGTCCCTGAAACATGGACTGATGGCCCCAAGGACACATCAGTGGAAGATGCTTTAGAAAGAACTTA
CGTGCCCCGGCTAAAGACATTAGAAGAAGATGTGATGGAGGCCATGGGGATCCAGGAGACTCGAAGATTC
AAGAAAATCTATTGGTATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001007637
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007637.1, NP_001007638.1
RefSeq Size 1619 bp
RefSeq ORF 651 bp
Locus ID 295224
UniProt ID Q66H47
Cytogenetics 2q34
Write Your Own Review
You're reviewing:mrpl24 (NM_001007637) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR207818 mrpl24 (Myc-DDK-tagged ORF) - Rat mitochondrial ribosomal protein L24 (mrpl24), nuclear gene encoding mitochondrial protein, (10 ug) 10 ug
$330.00
RR207818L3 Lenti ORF clone of mrpl24 (Myc-DDK-tagged ORF) - Rat mitochondrial ribosomal protein L24 (mrpl24), nuclear gene encoding mitochondrial protein, (10 ug) 10 ug
$630.00
RR207818L4 Lenti ORF clone of mrpl24 (mGFP-tagged ORF) - Rat mitochondrial ribosomal protein L24 (mrpl24), nuclear gene encoding mitochondrial protein, (10 ug) 10 ug
$630.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.