Mcpt4 (NM_019321) Rat Untagged Clone

SKU
RN201959
Mcpt4 (untagged ORF) - Rat mast cell protease 4 (Mcpt4), (10 ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Mcpt4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN201959 representing NM_019321
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGCCCTGCTATTCCTGATGGCTCTTCTCTTGCCTTCTGGAGCTGGAGCTGAGGAGATTATCGGTG
GTGTGGAGTCTATTCCTCACTCCCGCCCTTACATGGCCCTTCTGAAGATCGTCACTGAAGAAGGTCATGT
GACCTTCTGTGGTGGGTTTCTCATAAGCCTTCAATTTGTGCTGACTGCTGCACACTGTCATGGAAGGGAA
ATCACTGTCACCCTCGGAGCTCATGACATGAGCAAGAGAGAATCCACACAACAAAAGATAAAAGTTGTAA
AACAAATCTTTCCTCTAAAGTACAATTTATTTTCCAATTTCCGTGACATCATGTTACTGAAGCTTGAACA
GAAAGCAGTGTTGACTCCGTCTGTGAATGTAATCCCCCTGCCTCAGTCCTCTGACATTATCAAGCCTGGG
ACAATGTGCTTGGCAGCTGGATGGGGACAAACTGGAGTGAAAGAACCGAACTCAAATACACTGAGGGAGG
TCATGCTGAGAATCATGGAAATGAAGGCCTGTAAGGACTATAGGCATTATGACAATAGATTCCAGATCTG
CGTGGGGATTCCTCAAATGTTGAAATTAGCATACAAGGGAGACTCTGGAGGACCTCTAGTGTGTGCTGGA
GTGGCCCATGGTATTGTATCTCATGGCCCTGGAAGAGGAATCCCCCCTATAATCTTCACCCGAATCTCCT
CATATGTGTCCTGGATTAATAGAGTCATAAGGGGAAATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_019321
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019321.2, NP_062194.1
RefSeq Size 943 bp
RefSeq ORF 741 bp
Locus ID 54270
UniProt ID P97592
Cytogenetics 15p13
Summary mast cell protease that acts as a beta-chymase; has a strong preference for bulky/aromatic amino acid residues in both the P1 and P2 positions [RGD, Feb 2006]
Write Your Own Review
You're reviewing:Mcpt4 (NM_019321) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR201959 Mcpt4 (Myc-DDK-tagged ORF) - Rat mast cell protease 4 (Mcpt4), (10 ug) 10 ug
$330.00
RR201959L3 Lenti ORF clone of Mcpt4 (Myc-DDK-tagged ORF) - Rat mast cell protease 4 (Mcpt4), (10 ug) 10 ug
$630.00
RR201959L4 Lenti ORF clone of Mcpt4 (mGFP-tagged ORF) - Rat mast cell protease 4 (Mcpt4), (10 ug) 10 ug
$630.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.