Bsg (NM_012783) Rat Untagged Clone

SKU
RN200442
Bsg (untagged ORF) - Rat basigin (Bsg), transcript variant 2, (10 ug)
$450.00
In Stock*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Bsg
Synonyms 5A11; basignin; CE9; EMMPRIN; HT7; Ox47R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN200442 representing NM_012783
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGCGCTGCTGCTGGCGCTGGCCTTCACGTTCCTGAGTGGCCAAGGCGCCTGCGCGGCGGCGG
GCACCATCGTAACCTCTGTCCAGGAAGTTGACTCCAAGACACAGCTTACCTGCTTTTTGAACAGCAGTGG
CATTGACATCGTTGGCCACCGCTGGATGAGAGGTGGCAAGGTACTGCAGGAAGACACGCTGCCCGATCTA
CAGATGAAGTACACGGTGGATGCAGATGACCGCTCTGGAGAATATTCCTGCATCTTCCTTCCTGAGCCTG
TGGGCAGAGGCAACATCAATGTGGAGGGGCCACCCAGGATCAAGGTGGGAAAGAAATCGGAACACGCCAG
TGAGGGAGAGTTTGTGAAGCTGATCTGCAAGTCTGAGGCGTCCCACCCTCCTGTGGATGAGTGGGTCTGG
TTTAAGACCTCTGACACTGGGGACCAGACTATCTCCAACGGCACTGAGGCCAATAGCAAGTACGTCATTA
TATCCACGCCTGAGCTGTCAGAGCTGATCATCAGCGACCTGGACATGAACGTGGACCCTGGCACCTACGT
GTGCAATGCCACCAACTCCCAGGGCAGTGCTCGGGAGACCATCTCACTGCGTGTGCGCAGCCGCCTGGCA
GCCCTCTGGCCCTTCCTGGGCATTGTGGCCGAGGTCCTGGTGTTGGTCACCATCATCTTCATCTACGAGA
AGAGGCGGAAGCCGGACCAGACCCTGGACGAGGATGATCCTGGCGCCGCCCCACTGAAGGGCAGCGGGTC
TCACCTGAATGACAAGGACAAGAATGTGCGCCAGAGGAACGCCACCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_012783
Insert Size 819 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012783.3, NP_036915.1
RefSeq Size 1333 bp
RefSeq ORF 819 bp
Locus ID 25246
UniProt ID P26453
Cytogenetics 7q11
Summary MRC OX-47 antigen that is upregulated on activated lymphocytes; member of the immunoglobulin superfamily [RGD, Feb 2006]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1.
Write Your Own Review
You're reviewing:Bsg (NM_012783) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR200442 Bsg (Myc-DDK-tagged ORF) - Rat basigin (Bsg), transcript variant 2, (10 ug) 10 ug
$480.00
RR200442L3 Lenti ORF clone of Bsg (Myc-DDK-tagged ORF) - Rat basigin (Bsg), transcript variant 2, (10 ug) 10 ug
$780.00
RR200442L4 Lenti ORF clone of Bsg (mGFP-tagged ORF) - Rat basigin (Bsg), transcript variant 2, (10 ug) 10 ug
$780.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.