RPE65 (NM_000329) Human Tagged ORF Clone

SKU
RG210433
RPE65 (tGFP-tagged) - Human retinal pigment epithelium-specific protein 65kDa (RPE65)
  • TrueORF®
    TrueORF®

    Expression-ready ORF plasmid with C-terminal tag(s)

    Click here to learn more.

$944.00
In Stock*
Specifications
Product Data
Type Human Tagged ORF Clone
Target Symbol RPE65
Synonyms BCO3; LCA2; mRPE65; p63; rd12; RP20; sRPE65
Vector pCMV6-AC-GFP
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>RG210433 representing NM_000329
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAAACTGTTTGAAACTGTGGAGGAACTGTCCT
CGCCGCTCACAGCTCATGTAACAGGCAGGATCCCCCTCTGGCTCACCGGCAGTCTCCTTCGATGTGGGCC
AGGACTCTTTGAAGTTGGATCTGAGCCATTTTACCACCTGTTTGATGGGCAAGCCCTCCTGCACAAGTTT
GACTTTAAAGAAGGACATGTCACATACCACAGAAGGTTCATCCGCACTGATGCTTACGTACGGGCAATGA
CTGAGAAAAGGATCGTCATAACAGAATTTGGCACCTGTGCTTTCCCAGATCCCTGCAAGAATATATTTTC
CAGGTTTTTTTCTTACTTTCGAGGAGTAGAGGTTACTGACAATGCCCTTGTTAATGTCTACCCAGTGGGG
GAAGATTACTACGCTTGCACAGAGACCAACTTTATTACAAAGATTAATCCAGAGACCTTGGAGACAATTA
AGCAGGTTGATCTTTGCAACTATGTCTCTGTCAATGGGGCCACTGCTCACCCCCACATTGAAAATGATGG
AACCGTTTACAATATTGGTAATTGCTTTGGAAAAAATTTTTCAATTGCCTACAACATTGTAAAGATCCCA
CCACTGCAAGCAGACAAGGAAGATCCAATAAGCAAGTCAGAGATCGTTGTACAATTCCCCTGCAGTGACC
GATTCAAGCCATCTTACGTTCATAGTTTTGGTCTGACTCCCAACTATATCGTTTTTGTGGAGACACCAGT
CAAAATTAACCTGTTCAAGTTCCTTTCTTCATGGAGTCTTTGGGGAGCCAACTACATGGATTGTTTTGAG
TCCAATGAAACCATGGGGGTTTGGCTTCATATTGCTGACAAAAAAAGGAAAAAGTACCTCAATAATAAAT
ACAGAACTTCTCCTTTCAACCTCTTCCATCACATCAACACCTATGAAGACAATGGGTTTCTGATTGTGGA
TCTCTGCTGCTGGAAAGGATTTGAGTTTGTTTATAATTACTTATATTTAGCCAATTTACGTGAGAACTGG
GAAGAGGTGAAAAAAAATGCCAGAAAGGCTCCCCAACCTGAAGTTAGGAGATATGTACTTCCTTTGAATA
TTGACAAGGCTGACACAGGCAAGAATTTAGTCACGCTCCCCAATACAACTGCCACTGCAATTCTGTGCAG
TGACGAGACTATCTGGCTGGAGCCTGAAGTTCTCTTTTCAGGGCCTCGTCAAGCATTTGAGTTTCCTCAA
ATCAATTACCAGAAGTATTGTGGGAAACCTTACACATATGCGTATGGACTTGGCTTGAATCACTTTGTTC
CAGATAGGCTCTGTAAGCTGAATGTCAAAACTAAAGAAACTTGGGTTTGGCAAGAGCCTGATTCATACCC
ATCAGAACCCATCTTTGTTTCTCACCCAGATGCCTTGGAAGAAGATGATGGTGTAGTTCTGAGTGTGGTG
GTGAGCCCAGGAGCAGGACAAAAGCCTGCTTATCTCCTGATTCTGAATGCCAAGGACTTAAGTGAAGTTG
CCCGGGCTGAAGTGGAGATTAACATCCCTGTCACCTTTCATGGACTGTTCAAAAAATCT


ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Restriction Sites SgfI-MluI Cloning Scheme for this gene Plasmid Map
ACCN NM_000329
ORF Size 1599 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000329.3
RefSeq Size 2608 bp
RefSeq ORF 1602 bp
Locus ID 6121
UniProt ID Q16518
Cytogenetics 1p31.3
Domains RPE65
Protein Families Druggable Genome
Protein Pathways Retinol metabolism
Summary The protein encoded by this gene is a component of the vitamin A visual cycle of the retina which supplies the 11-cis retinal chromophore of the photoreceptors opsin visual pigments. It is a member of the carotenoid cleavage oxygenase superfamily. All members of this superfamily are non-heme iron oxygenases with a seven-bladed propeller fold and oxidatively cleave carotenoid carbon:carbon double bonds. However, the protein encoded by this gene has acquired a divergent function that involves the concerted O-alkyl ester cleavage of its all-trans retinyl ester substrate and all-trans to 11-cis double bond isomerization of the retinyl moiety. As such, it performs the essential enzymatic isomerization step in the synthesis of 11-cis retinal. Mutations in this gene are associated with early-onset severe blinding disorders such as Leber congenital. [provided by RefSeq, Oct 2017]
Write Your Own Review
You're reviewing:RPE65 (NM_000329) Human Tagged ORF Clone
Your Rating
SKU Description Size Price
RC210433 RPE65 (Myc-DDK-tagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$744.00
RC210433L1 Lenti-ORF clone of RPE65 (Myc-DDK-tagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$1,044.00
RC210433L2 Lenti-ORF clone of RPE65 (mGFP-tagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$1,044.00
RC210433L3 Lenti-ORF clone of RPE65 (Myc-DDK-tagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$1,044.00
RC210433L4 Lenti-ORF clone of RPE65 (mGFP-tagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$1,044.00
SC119977 RPE65 (untagged)-Human retinal pigment epithelium-specific protein 65kDa (RPE65) 10 ug
$745.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.