Pax9 (NM_011041) Mouse Tagged ORF Clone

SKU
MG205145
Pax9 (tGFP-tagged) - Mouse paired box gene 9 (Pax9)
  • TrueORF®
    TrueORF®

    Expression-ready ORF plasmid with C-terminal tag(s)

    Click here to learn more.

$489.00 MSRP $657.00 MSRP $657.00
In Stock*
Specifications
Product Data
Type Mouse Tagged ORF Clone
Target Symbol Pax9
Synonyms Pax; Pax-9
Vector pCMV6-AC-GFP
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>MG205145 representing NM_011041
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCAGCCTTCGGGGAGGTGAACCAGCTGGGAGGAGTGTTCGTGAACGGAAGGCCGCTGCCCAACG
CCATTCGGCTTCGCATCGTGGAATTAGCCCAACTGGGCATCCGACCTTGTGACATCAGCCGCCAGCTACG
GGTCTCGCACGGCTGCGTCAGCAAGATCCTGGCGCGCTACAACGAGACCGGTTCGATTTTGCCGGGAGCT
ATTGGGGGGAGCAAGCCCCGGGTCACCACCCCTACTGTGGTGAAACACATCCGGACTTACAAGCAGAGGG
ACCCAGGCATCTTCGCTTGGGAGATCCGGGACCGCCTGCTGGCGGATGGCGTGTGCGACAAGTACAACGT
GCCCTCGGTGAGTTCCATCAGCCGTATTCTGCGCAACAAGATCGGCAACTTGGCCCAGCAGGGTCATTAC
GACTCTTACAAGCAGCACCAGCCCGCGCCGCAGCCCGCGCTGCCCTACAACCACATTTACTCATATCCCA
GTCCCATCACGGCGGCAGCAGCTAAGGTGCCTACACCACCTGGGGTGCCGGCCATCCCCGGATCGGTGGC
CTTGCCGCGCACCTGGCCCTCCTCTCACTCCGTCACGGACATTCTGGGCATCCGCTCCATCACCGACCAA
GGAGTGAGCGACAGCTCCCCCTACCACAGCCCCAAGGTGGAGGAGTGGAGCAGCCTGGGCCGCAACAACT
TCCCTGCCGCCGCCCCGCACGCAGTGAATGGATTGGAGAAGGGAGCCTTGGAGCAGGAAGCCAAGTACGG
CCAGGCACCGAATGGTCTCCCAGCTGTGAGCAGTTTCGTCTCAGCATCCAGCATGGCTCCTTACCCTACA
CCAGCCCAAGTGTCACCCTACATGACCTACAGTGCTGCTCCTTCTGGTTATGTGGCTGGACATGGGTGGC
AACATGCCGGCAGCACCCCACTGTCCCCCCACAACTGTGACATTCCCGCATCGCTGGCTTTCAAGGGAAT
GCAGGCAGCCAGGGAAGGCAGCCATTCTGTGACCGCTTCTGCACTC


ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI Cloning Scheme for this gene Plasmid Map
ACCN NM_011041
ORF Size 1026 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011041.1
RefSeq Size 2574 bp
RefSeq ORF 1029 bp
Locus ID 18511
UniProt ID P47242
Cytogenetics 12 24.53 cM
Summary This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
Write Your Own Review
You're reviewing:Pax9 (NM_011041) Mouse Tagged ORF Clone
Your Rating
SKU Description Size Price
MC205704 Pax9 (untagged) - Mouse paired box gene 9 (Pax9), (10ug) 10 ug
$457.00
MR205145 Pax9 (Myc-DDK-tagged) - Mouse paired box gene 9 (Pax9) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205145L3 Lenti ORF clone of Pax9 (Myc-DDK-tagged) - Mouse paired box gene 9 (Pax9) 10 ug
$757.00
MR205145L4 Lenti ORF clone of Pax9 (mGFP-tagged) - Mouse paired box gene 9 (Pax9) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.