Oprk1 (NM_001204371) Mouse Untagged Clone

SKU
MC227386
Oprk1 (untagged) - Mouse opioid receptor, kappa 1 (Oprk1), transcript variant 1
  $457.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Oprk1
Synonyms K-OR-1; KOR; KOR-1; MSL-1; Op; Oprk2; R2; R21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209123 representing NM_011011
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCCCCATTCAGATCTTCCGAGGAGATCCAGGCCCTACCTGCTCTCCCAGTGCTTGCCTTCTCC
CCAACAGCAGCTCTTGGTTCCCCAACTGGGCAGAATCCGACAGTAATGGCAGTGTGGGCTCAGAGGATCA
GCAGCTGGAGTCCGCGCACATCTCTCCGGCCATCCCTGTTATCATCACCGCTGTCTACTCTGTGGTATTT
GTGGTGGGCTTAGTGGGCAATTCTCTGGTCATGTTTGTCATCATCCGATACACGAAGATGAAGACCGCAA
CCAACATCTACATATTTAACCTGGCTTTGGCAGATGCTTTGGTTACTACCACTATGCCCTTTCAGAGTGC
TGTCTACTTGATGAATTCTTGGCCTTTTGGAGATGTGCTATGCAAGATTGTCATTTCCATTGACTACTAC
AACATGTTTACCAGCATATTCACCTTGACCATGATGAGTGTGGACCGCTACATTGCTGTGTGCCACCCTG
TGAAAGCTTTGGACTTCCGAACACCTTTGAAAGCAAAGATCATCAACATCTGCATTTGGCTCCTGGCATC
ATCTGTTGGTATATCAGCGATAGTCCTTGGAGGCACCAAAGTCAGGGAAGATGTGGATGTCATTGAATGC
TCCTTGCAGTTTCCTGATGATGAATATTCCTGGTGGGATCTCTTCATGAAGATCTGTGTCTTCGTCTTTG
CCTTTGTGATCCCAGTCCTCATCATCATTGTCTGCTACACCCTGATGATCCTGCGCCTGAAGAGTGTCCG
GCTCCTGTCTGGCTCCCGAGAGAAGGACCGAAATCTCCGCCGCATCACCAAGCTGGTGCTGGTAGTAGTT
GCAGTCTTCATCATCTGTTGGACCCCCATTCACATCTTTATCCTGGTGGAGGCTCTGGGAAGCACCTCCC
ACAGCACAGCTGCCCTCTCCAGCTATTATTTCTGTATTGCCTTGGGTTATACCAACAGCAGCCTGAATCC
TGTTCTCTATGCCTTTCTGGATGAAAACTTCAAGCGGTGTTTTAGGGACTTCTGCTTCCCTATTAAGATG
CGAATGGAGCGCCAGAGCACCAATAGAGTTAGAAACACAGTTCAGGATCCTGCTTCCATGAGAGATGTGG
GAGGGATGAATAAGCCAGTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001204371
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001204371.1, NP_001191300.1
RefSeq Size 4707 bp
RefSeq ORF 1143 bp
Locus ID 18387
UniProt ID P33534
Cytogenetics 1 1.89 cM
Summary This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. provided by RefSeq, Dec 2017
Transcript Variant: This variant (1) represents the longer transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (1). Variants 1 and 2 encode the same isoform.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001204371" in other vectors (1)
SKU Description Size Price
MR229597 Oprk1 (myc-DDK-tagged) - Mouse opioid receptor, kappa 1 (Oprk1), transcript variant 1 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.