Fasl (NM_001205243) Mouse Untagged Clone

SKU MC225813

Fasl (untagged) - Mouse Fas ligand (TNF superfamily, member 6) (Fasl), transcript variant 2

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Fasl
• Synonyms: APT1LG1; CD95-L; CD95L; CD178; Fas-L; Faslg; gld; Tnfsf6; Tnlg1a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225813 representing NM_001205243; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGCAGCAGCCCATGAATTACCCATGTCCCCAGATCTTCTGGGTAGACAGCAGTGCCACTTCATCTTGGG; CTCCTCCAGGGTCAGTTTTTCCCTGTCCATCTTGTGGGCCTAGAGGGCCGGACCAAAGGAGACCGCCACC; TCCACCACCACCTGTGTCACCACTACCACCGCCATCACAACCACTCCCACTGCCGCCACTGACCCCTCTA; AAGAAGAAGGACCACAACACAAATCTGTGGCTACCGGTGGTATTTTTCATGGTTCTGGTGGCTCTGGTTG; GAATGGGATTAGGAATGTATCAGCTCTTCCACCTGCAGAAGGAACTGGCAGAACTCCGTGAGCCAACCCC; AGTACACCCTCTGAAAAAAAAGAGCCGAGGAGTGTGGCCCATTTAA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Chromatograms: Chromatograms ; Sequencher program is needed, download here
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205243
• Insert Size: 396 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001205243.1, NP_001192172.1
• RefSeq Size: 1889 bp
• RefSeq ORF: 396 bp
• Locus ID: 14103
• Cytogenetics: 1 69.95 cM
• Summary: Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells (PubMed:7511063). Involved in cytotoxic T-cell-mediated apoptosis, natural killer cell-mediated apoptosis and in T-cell development (PubMed:19794494, PubMed:7532682). Initiates fratricidal/suicidal activation-induced cell death (AICD) in antigen-activated T-cells contributing to the termination of immune responses (PubMed:19794494). TNFRSF6/FAS-mediated apoptosis has also a role in the induction of peripheral tolerance (PubMed:10779162). Binds to TNFRSF6B/DcR3, a decoy receptor that blocks apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.