Vamp5 (NM_001080742) Mouse Untagged Clone

SKU MC225631

Vamp5 (untagged) - Mouse vesicle-associated membrane protein 5 (Vamp5), transcript variant 2

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Vamp5
• Synonyms: AF119384; Camp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225631 representing NM_001080742; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGGCAGGGAAAGAACTGAAGCAATGCCAGCAGCAGGCGGACGAAGTGACGGAAATCATGCTCAACAATT; TCGACAAGGTCCTGGAGCGTCACGGCAAGCTGGCGGAGTTGGAGCAGCGTTCAGACCAGCTCCTGGACAT; GAGTTCGGCCTTCAGCAAGACAACCAAGACTTTAGCCCAGCAGAAGCGCTGGGAAAATATCCGGTGCCGG; GTCTACTTGGGGCTAGCAGTGGCTGTTGGCCTGCTCATCATCCTGATTGTGTTGCTGGTCGTCTTTCTTC; CGAGTGGTGGGGACAGTAGTAAACCATAG; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080742
• Insert Size: 309 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001080742.2, NP_001074211.1
• RefSeq Size: 1538 bp
• RefSeq ORF: 309 bp
• Locus ID: 53620
• UniProt ID: Q9Z2P8
• Cytogenetics: 6 C1
• Summary: May participate in trafficking events that are associated with myogenesis, such as myoblast fusion and/or GLUT4 trafficking.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.