Zfp804a (NM_175513) Mouse Untagged Clone

SKU
MC223928
Zfp804a (untagged) - Mouse zinc finger protein 804A (Zfp804a), (10ug)
$1,045.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Zfp804a
Synonyms C630007C17Rik; Znf804a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC223928 representing NM_175513
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_175513
Insert Size 3603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175513.3, NP_780722.2
RefSeq Size 4196 bp
RefSeq ORF 3603 bp
Locus ID 241514
UniProt ID A2AKY4
Cytogenetics 2 D
Write Your Own Review
You're reviewing:Zfp804a (NM_175513) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG217143 Zfp804a (tGFP-tagged) - Mouse zinc finger protein 804A (Zfp804a), (10ug) 10 ug
$789.00 MSRP $1,244.00 MSRP $1,244.00
MR217143 Zfp804a (Myc-DDK-tagged) - Mouse zinc finger protein 804A (Zfp804a) 10 ug
$589.00 MSRP $1,044.00 MSRP $1,044.00
MR217143L3 Lenti ORF clone of Zfp804a (Myc-DDK-tagged) - Mouse zinc finger protein 804A (Zfp804a) 10 ug
$1,344.00
MR217143L4 Lenti ORF clone of Zfp804a (mGFP-tagged) - Mouse zinc finger protein 804A (Zfp804a) 10 ug
$1,344.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.