Tert (NM_009354) Mouse Untagged Clone

SKU
MC223645
Tert (untagged) - Mouse telomerase reverse transcriptase (Tert), (10ug)
  $1,466.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tert
Synonyms EST2; TCS1; TP2; TR; TRT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC223645 representing NM_009354
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_009354
Insert Size 3369 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009354.1, NP_033380.1
RefSeq Size 3426 bp
RefSeq ORF 3369 bp
Locus ID 21752
UniProt ID O70372
Cytogenetics 13 40.12 cM
Summary Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells. Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template sequence within the RNA component of the enzyme. Catalyzes the RNA-dependent extension of 3'-chromosomal termini with the 6-nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer extension and release of product once the template boundary has been reached or nascent product translocation followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_009354" in other vectors (4)
SKU Description Size Price
MG226892 Tert (tGFP-tagged) - Mouse telomerase reverse transcriptase (Tert), (10ug) 10 ug
$789.00 $1,665.00
MR226892 Tert (Myc-DDK-tagged) - Mouse telomerase reverse transcriptase (Tert) 10 ug
$589.00 $1,465.00
MR226892L3 Lenti ORF clone of Tert (Myc-DDK-tagged) - Mouse telomerase reverse transcriptase (Tert) 10 ug
$1,765.00
MR226892L4 Lenti ORF clone of Tert (mGFP-tagged) - Mouse telomerase reverse transcriptase (Tert) 10 ug
$1,765.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.