OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Birc3 (BC011338) Mouse Untagged Clone

Be the first to review this product
SKU
MC218138
Birc3 (untagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Birc3 or BC011338"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Birc3
Synonyms IAP1, MIAP1, Birc2, cIAP1, cIAP-1, MIHB, HIAP2, Api2, IAP2, MIHC, MIAP2, RNF49, cIAP2, cIAP-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC011338
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACATGGTTCAAGACAGTGCCTTTCTAGCCAAGCTGATGAAGAGTGCTGACACCTTTGAGTTGAAGT
ATGACTTTTCCTGTGAGCTGTACCGATTGTCCACATATTCAGCTTTTCCCAGGGGAGTTCCTGTGTCAGA
AAGGAGTCTGGCTCGTGCTGGCTTTTACTACACTGGTGTCAATGACAAGGTCAAGTGCTTCTGCTGTGGC
CTAATGCTAGACAACTGGAAACAAGGGGGCAGTCCCATGGAGAAGCACAGAAAGTTGTACCCCAGCTGCA
ACTTTGTACAGACTTTGAATCCAGCCAACAGTCTGGAAGCTAGTCCTCGGCCTTCTCTTCCTTCCACGGC
GATGAGCACCATGCCTTTGAGCTTTGCAAGTTCTGAGAACACTGGCTATTTCAGTGGCTCTTACTCGAGC
TTTCCCTCAGACCCTGTGAACTTCCGAGCAAATCAAGATTGTCCTGCTTTGAGCACAAGTCCCTACCACT
TTGCAATGAACACAGAGAAGGCCAGATTACTCACCTATGAAACATGGCCATTGTCTTTTCTGTCACCAGC
AAAGCTGGCCAAAGCAGGCTTCTACTACATAGGACCTGGAGATAGAGTGGCCTGCTTTGCGTGCGATGGG
AAACTGAGCAACTGGGAACGTAAGGATGATGCTATGTCAGAGCACCAGAGGCATTTCCCCAGCTGCCCGT
TCTTAAAAGACTTGGGTCAGTCTGCTTCGAGATACACTGTCTCTAACCTGAGCATGCAGACACACGCAGC
CCGTATTAGAACATTCTCTAACTGGCCTTCTAGTGCACTAGTTCATTCCCAGGAACTTGCAAGTGCGGGC
TTTTATTATACAGGACACAGTGATGATGTCAAGTGTTTTTGCTGTGATGGTGGGCTGAGGTGCTGGGAAT
CTGGAGATGACCCCTGGGTGGAACATGCCAAGTGGTTTCCAAGGTGTGAGTACTTGCTCAGAATCAAAGG
CCAAGAATTTGTCAGCCAAGTTCAAGCTGGCTATCCTCATCTACTTGAGCAGCTATTATCTACGTCAGAC
TCCCCAGAAGATGAGAATGCAGACGCAGCAAGTATGTATAATAATCATAATTCCTGCATTACACTGCTCC
GTTTTGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC011338
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC011338, AAH11338
RefSeq Size 2979 bp
RefSeq ORF 1130 bp
Locus ID 11796
Cytogenetics 9 A1
Summary Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, IKBKE, TRAF1, and BCL10. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC011338" in other vectors (4)
SKU Description Size Price
MG205838 Birc3 (tGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$657.00
MR205838 Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$289.00 $457.00
MR205838L3 Lenti ORF clone of Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$757.00
MR205838L4 Lenti ORF clone of Birc3 (mGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$757.00

file-alt Citations

IL-1β induces up-regulation of BIRC3, a gene involved in chemoresistance to doxorubicin in breast cancer cells
Mendoza-Rodríguez, Arévalo Romero, Fuentes-Pananá et al
Cancer Lett. (2017) 390, 39-44 DOI: 10.1016/j.canlet.2017.01.005
AI Summary: OriGene’s human BIRC3 siRNA Kit (Trilencer-27) was used to knock down BIRC3 expression, enabling the authors to demonstrate that reducing BIRC3 levels sensitized breast cancer cells to doxorubicin, thereby linking BIRC3 to chemoresistance.
Snippet: doxorubicin. To evaluate the direct participation of BIRC3 in the chemoresistance to doxorubicin, BIRC3 knocked down cells were obtained using a human BIRC3 siRNA Kit (Trilencer-27, OriGene Technologies, Rockville, MD, USA). ... Cite SaveSaving
MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
Yeung, Yao, Jia et al
Nat Microbiol (2016) 1 (3), 16004 DOI: 10.1038/nmicrobiol.2016.4
Cited by 186
AI Summary: OriGene products contributed to this study by providing the Smad7 and FGF2 expression plasmids (Cat# RC210722 and RC211369) and Smad7 shRNA plasmid (Cat# TG313763), which were used to manipulate gene expression and investigate their roles in MERS-CoV-induced apoptosis.
FigureFigureFigure
NPD1-mediated stereoselective regulation of BIRC3 expression through cREL is decisive for neural cell survival
Calandria, Asatryan, Balaszczuk et al
Cell Death Differ. (2015)
Cited by 47
AI Summary: OriGene products contributed to this study by providing Trilencer-27 siRNA knockdown duplexes for silencing BIRC3 and cREL expression, and the pCMV-XL5 vector for subcloning mutated ORFs, enabling investigation of gene function in neural cell survival.
Snippet: BIRC3 and cREL expression was silenced using a mixture of three siRNA commercially available as Trilencer-27 siRNA knockdown duplexes kit (Origene, Rockville, MD, USA). ... The mutated ORFs were subcloned in pCMV-XL5 (Origene) using SacI and XbaI restriction ... Cite SaveSaving
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products