Birc3 (BC011338) Mouse Untagged Clone

SKU
MC218138
Birc3 (untagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563), (10ug)
$503.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Birc3
Synonyms IAP1, MIAP1, Birc2, cIAP1, cIAP-1, MIHB, HIAP2, Api2, IAP2, MIHC, MIAP2, RNF49, cIAP2, cIAP-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC011338
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACATGGTTCAAGACAGTGCCTTTCTAGCCAAGCTGATGAAGAGTGCTGACACCTTTGAGTTGAAGT
ATGACTTTTCCTGTGAGCTGTACCGATTGTCCACATATTCAGCTTTTCCCAGGGGAGTTCCTGTGTCAGA
AAGGAGTCTGGCTCGTGCTGGCTTTTACTACACTGGTGTCAATGACAAGGTCAAGTGCTTCTGCTGTGGC
CTAATGCTAGACAACTGGAAACAAGGGGGCAGTCCCATGGAGAAGCACAGAAAGTTGTACCCCAGCTGCA
ACTTTGTACAGACTTTGAATCCAGCCAACAGTCTGGAAGCTAGTCCTCGGCCTTCTCTTCCTTCCACGGC
GATGAGCACCATGCCTTTGAGCTTTGCAAGTTCTGAGAACACTGGCTATTTCAGTGGCTCTTACTCGAGC
TTTCCCTCAGACCCTGTGAACTTCCGAGCAAATCAAGATTGTCCTGCTTTGAGCACAAGTCCCTACCACT
TTGCAATGAACACAGAGAAGGCCAGATTACTCACCTATGAAACATGGCCATTGTCTTTTCTGTCACCAGC
AAAGCTGGCCAAAGCAGGCTTCTACTACATAGGACCTGGAGATAGAGTGGCCTGCTTTGCGTGCGATGGG
AAACTGAGCAACTGGGAACGTAAGGATGATGCTATGTCAGAGCACCAGAGGCATTTCCCCAGCTGCCCGT
TCTTAAAAGACTTGGGTCAGTCTGCTTCGAGATACACTGTCTCTAACCTGAGCATGCAGACACACGCAGC
CCGTATTAGAACATTCTCTAACTGGCCTTCTAGTGCACTAGTTCATTCCCAGGAACTTGCAAGTGCGGGC
TTTTATTATACAGGACACAGTGATGATGTCAAGTGTTTTTGCTGTGATGGTGGGCTGAGGTGCTGGGAAT
CTGGAGATGACCCCTGGGTGGAACATGCCAAGTGGTTTCCAAGGTGTGAGTACTTGCTCAGAATCAAAGG
CCAAGAATTTGTCAGCCAAGTTCAAGCTGGCTATCCTCATCTACTTGAGCAGCTATTATCTACGTCAGAC
TCCCCAGAAGATGAGAATGCAGACGCAGCAAGTATGTATAATAATCATAATTCCTGCATTACACTGCTCC
GTTTTGCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC011338
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC011338, AAH11338
RefSeq Size 2979 bp
RefSeq ORF 1130 bp
Locus ID 11796
Cytogenetics 9 A1
Summary Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, IKBKE, TRAF1, and BCL10. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Birc3 (BC011338) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205838 Birc3 (tGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$657.00
MR205838 Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205838L3 Lenti ORF clone of Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$757.00
MR205838L4 Lenti ORF clone of Birc3 (mGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.