Nudt18 (BC036718) Mouse Untagged Clone

SKU
MC217977
Nudt18 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 18 (cDNA clone MGC:38179 IMAGE:5322150), (10ug)
$330.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nudt18
Synonyms MGC38179
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC036718
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACCAGGAGAAACCATCGTGGAGGCCATGCAGCGGGAGGTGAAGGAGGAGGCGGGGCTGCTCTGTG
AGCCAGTGACACTGCTGTCCGTGGAGGAGAGGGGCGCCTCCTGGATCCGCTTTGTGTTCCTCGCTCGACC
AACAGGCGGAGTTCTCAAGACTTCCAAAGATGCTGATTCTGAGTCCCTCCAGGCCGGCTGGTACCCACGG
GTCTCCCTGCCCACACCGCTTAGAGCCCATGATGTTCTGCACCTGGTAGAGCTAGGCGCCAAATTCTGCC
AACAAGCCATGCACCCTCTCATTCTGCCTCAAGAGCTCCCCTGCAGTGTGGTCTGCCAACGGCTGGTGAC
CACCTTCACAACAGTCCAGTCGGTGTGGGTGTTGGTGGGCACGGTGGGGACACCTCACTTGCCCATCACT
GCCTGTGGCTTTACCCCTATGGAACAAAGGGGCGGCATCAAGGTGGCCATCTTGAGGCTCCTACAGGAGT
GTCTGACTCTGCACAGTTTGGCAGTGGAGACCAAGGGGTTGCTTGGGTTGCAACACCTAGGCAGAGACCA
TGTGGATGGTGTCTGCCTGAATGTGCTGGTGACCGTGGCTTTTCGGAACCCAGGAATCCAAGACGAGCCC
CCAAAGATTCGGGGTGAAAACTACTTTTGGTGGAAGGTATTAGAGGAAGATTTACAAAAACTGCTTCTGT
ACAGACTCCAGGAATCTTCTGTGATCCCCCTGAGCAGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC036718
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC036718, AAH36718
RefSeq Size 1630 bp
RefSeq ORF 740 bp
Locus ID 213484
Cytogenetics 14 D2
Summary Mediates the hydrolyzis of oxidized nucleoside diphosphate derivatives. Hydrolyzes 8-oxo-7,8-dihydroguanine (8-oxo-Gua)-containing deoxyribo- and ribonucleoside diphosphates to the monophosphates. Hydrolyzes 8-oxo-dGDP and 8-oxo-GDP with the same efficiencies. Hydrolyzes also 8-OH-dADP and 2-OH-dADP. Exhibited no or minimal hydrolyzis activity against 8-oxo-dGTP, 8-oxo-GTP, dGTP, GTP, dGDP and GDP. Probably removes oxidized guanine nucleotides from both the DNA and RNA precursor pools (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Nudt18 (BC036718) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203089 Nudt18 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 18 (cDNA clone MGC:38179 IMAGE:5322150) 10 ug
$500.00
MR203089 Nudt18 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 18 (cDNA clone MGC:38179 IMAGE:5322150) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203089L3 Lenti ORF clone of Nudt18 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 18 (cDNA clone MGC:38179 IMAGE:5322150) 10 ug
$600.00
MR203089L4 Lenti ORF clone of Nudt18 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 18 (cDNA clone MGC:38179 IMAGE:5322150) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.