Psmc5 (BC030840) Mouse Untagged Clone

SKU
MC217736
Psmc5 (untagged) - Mouse protease (prosome, macropain) 26S subunit, ATPase 5 (cDNA clone MGC:31044 IMAGE:3994523), (10ug)
$503.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Psmc5
Synonyms mSUG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030840
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCTTGATGGGCCAGAGCAGATGGAACTGGAAGAGGGGAAGGCAGGCAGTGGACTCCGTCAATATT
ATCTGTCCAAGATTGAAGAACTCCAGTTGATTGTAAATGATAAGAGCCAGAATCTCCGTAGACTGCAGGC
ACAGAGGAATGAGCTGAATGCAAAAGTTCGCCTGTTGCGGGAGGAGCTGCAGCTGTTGCAGGAACAGGGC
TCCTACGTTGGAGAAGTCGTGAGGGCCATGGATAAGAAAAAAGTATTGGTCAAGGTCCATCCTGAGGGCA
AATTTGTTGTTGATGTGGACAAGAACATTGATATCAACGATGTGACGCCCAATTGTCGGGTCGCTCTAAG
AAATGACAGCTACACTCTGCATAAGATCTTACCTAACAAGGTGGACCCTTTGGTGTCACTAATGATGGTG
GAGAAGGTGCCAGACTCAACCTACGAGATGATTGGCGGCCTGGACAAGCAGATCAAGGAGATTAAAGAAG
TGATCGAGCTGCCCGTGAAGCACCCCGAGCTCTTTGAAGCACTGGGCATCGCACAGCCAAAGGGAGTCCT
GCTCTACGGACCCCCAGGCACTGGGAAGACATTGTTGGCCCGCGCTGTGGCTCATCATACAGACTGTACC
TTTATTCGTGTCTCTGGCTCTGAACTGGTACAGAAATTCATCGGGGAAGGGGCAAGAATGGTGAGGGAGC
TGTTTGTCATGGCCCGAGAACATGCTCCATCCATCATCTTCATGGACGAGATTGACTCTATTGGCTCCTC
ACGGCTGGAGGGGGGCTCTGGAGGCGACAGTGAGGTACAGCGCACGATGCTGGAACTGCTCAATCAGCTG
GATGGCTTTGAGGCCACCAAGAATATCAAGGTTATCATGGCTACTAATAGGATTGATATCCTGGACTCTG
CCCTGCTTCGTCCTGGGAGGATTGACAGAAAAATTGAATTCCCACCCCCCAACGAGGAGGTCTGTGCTGG
AGGTGCCTGGAGAAGCTCTGGCTATGGAGACAGTGCAGGGCTTAGGGCTTTCTTCTCTTATCCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC030840
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030840, AAH30840
RefSeq Size 1415 bp
RefSeq ORF 1046 bp
Locus ID 19184
Cytogenetics 11 E1
Summary Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair. PSMC5 belongs to the heterohexameric ring of AAA (ATPases associated with diverse cellular activities) proteins that unfolds ubiquitinated target proteins that are concurrently translocated into a proteolytic chamber and degraded into peptides.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Psmc5 (BC030840) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205252 Psmc5 (tGFP-tagged) - Mouse protease (prosome, macropain) 26S subunit, ATPase 5 (cDNA clone MGC:31044 IMAGE:3994523) 10 ug
$657.00
MR205252 Psmc5 (Myc-DDK-tagged) - Mouse protease (prosome, macropain) 26S subunit, ATPase 5 (cDNA clone MGC:31044 IMAGE:3994523) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205252L3 Lenti ORF clone of Psmc5 (Myc-DDK-tagged) - Mouse protease (prosome, macropain) 26S subunit, ATPase 5 (cDNA clone MGC:31044 IMAGE:3994523) 10 ug
$757.00
MR205252L4 Lenti ORF clone of Psmc5 (mGFP-tagged) - Mouse protease (prosome, macropain) 26S subunit, ATPase 5 (cDNA clone MGC:31044 IMAGE:3994523) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.