Irx3 (NM_008393) Mouse Untagged Clone

SKU
MC217138
Irx3 (untagged) - Mouse Iroquois related homeobox 3 (Drosophila) (Irx3), (10ug)
$709.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Irx3
Synonyms AI894186
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_008393, the custom clone sequence may differ by one or more nucleotides


ATGTCCTTCCCCCAGCTCGGATACCAGTACATCCGCCCTCTCTACCCACCCGAACGCCCGGGAGCTGCGG
GCGGCGGTGGAGGCGGCAGTAGCGCTGGGGGCCGGAGCGGTCCCGGCGCCGGAGCCTCCGAGTTGGCCGC
CTCTGGGTCCCTATCCAATGTGCTTTCATCAGTGTACGGGGCACCCTACGCCGCTGCCGCAGCTGCCGCC
GCCGCCGCTCAGGGTTACGGCGCCTTCCTGCCCTACGCCACGGAGCTGCCCATCTTCCCACAGCTGGGCG
CTCAGTATGAGCTGAAGGACAGCCCTGGCGTCCAGCATCCGGCCACGGCCGCCGCGTTCCCGCACCCGCA
CCCCGCCTTCTACCCCTATGGCCAGTACCAGTTCGGGGACCCGTCCCGTCCCAAGAACGCCACCCGGGAA
AGCACGAGCACGCTCAAGGCCTGGCTCAACGAGCACCGCAAGAACCCGTACCCCACCAAGGGCGAGAAGA
TCATGTTGGCCATCATCACCAAGATGACCCTCACCCAGGTGTCCACCTGGTTCGCCAACGCGCGCCGGCG
CCTCAAGAAGGAGAACAAGATGACGTGGGCTCCCCGTAGTCGCACGGACGAGGAGGGCAATGCTTATGGG
AGCGAGCGGGAGGAGGAGGACGAAGAGGAAGACGAGGAAGAGAGCAAACGCGAGCTGGAGATGGAGGAGG
AGGAGCTCGCAGGAGAGGAGGAGGACACGGGGGGCGAGGGGCTGGCCGACGACGACGAGGATGAGGAGAT
CGATTTGGAAAACTTAGACAGCGCGGCAGCCGGGTCGGAGCTGACCCTGGCTGGGGCGGCGCACAGGAAC
GGCGACTTCGGCCTGGGACCCATTTCGGACTGCAAAACTAGCGACTCGGACGACAGCTCCGAAGGCTTGG
AGGACCGACCACTGTCGGTCCTGAGCCTGGCCCCACCGCCACCGCCCGTGGCCAGGGCTCCTGCATCTCC
ACCTTCTCCACCCTCCAGCCTGGATCCCTGCGCTCCGGCCCCGGCGCCCTCCTCCGCCCTCCAGAAGCCC
AAGATCTGGTCACTGGCCGAGACGGCCACCAGCCCGGACAACCCACGCCGCTCGCCTCCCGGAGCCGGAG
GTTCGCCTCCCGGCGCAGCCGTTGCGCCCCCGACGCTGCAGCTCTCGCCCGCGGCCGCTGCAGCGGCTGC
AGCGGCACACAGACTCGTGTCGGCGCCGCTTGGCAAATTCCCCGCTTGGACCAACAGGCCTTTCCCAGGG
CCGCCGGCCGGTCCGCGGCCGCACCCGCTGTCCATGCTGGGCTCGGCCCCACAGCACCTGCTGGGACTTC
CCGGAGCCGCAGGTCATCCCGCTGCGGCCGCAGCCGCCTATGCTCGGCCTGCCGAGCCGGAGAGTGGAAC
AGATCGCTGTAGTGCCTTGGAAGTGGAGAAAAAGTTACTCAAGACAGCTTTCCAGCCGGTGCCAAGGCGG
CCACAGAACCATCTGGACGCTGCTCTGGTCTTATCAGCTCTCTCCTCGTCTTAA


Restriction Sites SgfI-MluI
ACCN NM_008393
Insert Size 1524 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC085500, AAH85500
RefSeq Size 2079 bp
RefSeq ORF 1524 bp
Locus ID 16373
UniProt ID P81067
Cytogenetics 8 44.55 cM
Summary Transcription factor involved in SHH-dependent neural patterning (PubMed:10830170, PubMed:15201216). Together with NKX2-2 and NKX6-1 acts to restrict the generation of motor neurons to the appropriate region of the neural tube (PubMed:10830170, PubMed:15201216). Belongs to the class I proteins of neuronal progenitor factors, which are repressed by SHH signals (PubMed:10830170, PubMed:15201216). Involved in the transcriptional repression of MNX1 in non-motor neuron cells (PubMed:15201216). Acts as a regulator of energy metabolism (PubMed:24646999).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:Irx3 (NM_008393) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG208149 Irx3 (tGFP-tagged) - Mouse Iroquois related homeobox 3 (Drosophila) (Irx3) 10 ug
$908.00
MR208149 Irx3 (Myc-DDK-tagged) - Mouse Iroquois related homeobox 3 (Drosophila) (Irx3) 10 ug
$708.00
MR208149L3 Lenti ORF clone of Irx3 (Myc-DDK-tagged) - Mouse Iroquois related homeobox 3 (Drosophila) (Irx3) 10 ug
$1,008.00
MR208149L4 Lenti ORF clone of Irx3 (mGFP-tagged) - Mouse Iroquois related homeobox 3 (Drosophila) (Irx3) 10 ug
$1,008.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.