Yap1 (NM_001171147) Mouse Untagged Clone

SKU
MC216820
Yap1 (untagged) - Mouse yes-associated protein 1 (Yap1), transcript variant 1, (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Yap1
Synonyms AI325207; Y; Yap; Yap65; Yk; Yki; yor; Yorkie
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216820 representing NM_001171147
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCCGCGCAACAGCCGCCGCCCCAGCCGGCCCCGCAAGGCCCCGCGCCGCCGTCCGTGTCTCCGG
CCGGGACCCCCGCGGCCCCGCCCGCACCCCCGGCCGGCCACCAGGTCGTGCACGTCCGCGGGGACTCGGA
GACCGACTTGGAGGCGCTCTTCAATGCCGTCATGAACCCCAAGACGGCCAACGTGCCTCAGACCGTGCCC
ATGCGGCTTCGCAAGCTGCCCGACTCCTTCTTCAAGCCGCCTGAGCCCAAGTCCCACTCGCGACAGGCCA
GTACTGATGCAGGTACTGCGGGAGCTCTGACTCCACAGCATGTTCGAGCTCACTCCTCTCCAGCCTCCCT
GCAGCTGGGTGCCGTTTCTCCTGGGACACTCACAGCCAGTGGCGTTGTCTCTGGCCCTGCCGCTGCCCCT
GCAGCTCAGCATCTCCGGCAGTCCTCCTTTGAGATCCCTGATGATGTACCACTGCCAGCAGGCTGGGAGA
TGGCCAAGACATCTTCTGGTCAAAGATACTTCTTAAATCACAACGATCAGACAACAACATGGCAGGACCC
CCGGAAGGCCATGCTTTCGCAACTGAACGTTCCTGCGCCTGCCAGCCCAGCGGTGCCCCAGACGCTGATG
AATTCTGCCTCAGGACCTCTTCCTGATGGATGGGAGCAAGCCATGACTCAGGATGGAGAAGTTTACTACA
TAAACCATAAGAACAAGACCACATCCTGGCTGGACCCAAGGCTGGACCCTCGTTTTGCCATGAACCAGAG
GATCACTCAGAGTGCTCCAGTGAAGCAGCCCCCACCCTTGGCTCCCCAGAGCCCACAGGGAGGCGTCCTG
GGTGGAGGCAGTTCCAACCAGCAGCAGCAAATACAGCTGCAGCAGTTACAGATGGAGAAGGAGAGACTGC
GGTTGAAACAACAGGAATTATTTCGGCAGGCAATACGGAATATCAATCCCAGCACAGCAAATGCTCCAAA
ATGTCAGGAATTAGCTCTGCGCAGCCAGTTGCCTACACTGGAGCAGGATGGAGGGACTCCGAATGCAGTG
TCTTCTCCTGGGATGTCTCAGGAATTGAGAACAATGACAACCAATAGTTCCGATCCCTTTCTTAACAGTG
GCACCTATCACTCTCGAGATGAGAGCACAGACAGCGGCCTCAGCATGAGCAGCTACAGCATCCCTCGGAC
CCCAGACGACTTCCTCAACAGTGTGGATGAAATGGATACAGGAGACACCATCAGCCAAAGCACCCTGCCG
TCACAGCAGAGCCGCTTCCCCGACTACCTGGAAGCCCTCCCTGGGACAAATGTGGACCTTGGCACACTGG
AAGGAGATGCAATGAACATAGAAGGGGAGGAGCTGATGCCCAGTCTGCAGGAAGCGCTGAGTTCCGAAAT
CTTGGACGTGGAGTCTGTGTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTCACGTGGTTATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_001171147
Insert Size 1467 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001171147.1, NP_001164618.1
RefSeq Size 4200 bp
RefSeq ORF 1467 bp
Locus ID 22601
UniProt ID P46938
Cytogenetics 9 A1
Summary This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:Yap1 (NM_001171147) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG226049 Yap1 (tGFP-tagged) - Mouse yes-associated protein 1 (Yap1) transcript variant 1, (10ug) 10 ug
$886.00
MR226049 Yap1 (Myc-DDK-tagged) - Mouse yes-associated protein 1 (Yap1), transcript variant 1 10 ug
$686.00
MR226049L3 Lenti ORF clone of Yap1 (Myc-DDK-tagged) - Mouse yes-associated protein 1 (Yap1), transcript variant 1 10 ug
$986.00
MR226049L4 Lenti ORF clone of Yap1 (mGFP-tagged) - Mouse yes-associated protein 1 (Yap1), transcript variant 1 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.