Acod1 (NM_008392) Mouse Untagged Clone

SKU
MC216802
Irg1 (untagged) - Mouse immunoresponsive gene 1 (Irg1), (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Acod1
Synonyms AI323667; CAD; Irg1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_008392, the custom clone sequence may differ by one or more nucleotides


ATGATGCTCAAGTCTGTCACAGAGAGCTTTGCTGGTATGATTCACGGCTTGAAAGTGAACCACCTGACAG
ATGGTATCATTCGGAGGAGCAAGAGGATGATCCTGGATTCTCTGGGCGTTGGCTTCCTGGGGACAGGCAC
AGAAGTGTTCCATAAAGTCACCCAATATAGTAAAATCTACAGTTCCAACACCTCCAGCACTGTTTGGGGT
CGACCAGACTTCAGGCTCCCACCGACATATGCTGCTTTTGTTAATGGTGTTGCTGTTCACTCCATGGATT
TTGATGACACATGGCACCCTGCCACCCACCCTTCTGGGGCTGTCCTACCTGTCCTCACAGCTCTATCGGA
AGCCCTGCCTCAGACTCCCAAGTTTTCTGGCCTCGACCTGCTGCTGGCGTTCAACGTTGGTATTGAAGTA
CAGGGACGATTAATGCACTTCTCCAAGGAAGCCAAAGACATACCAAAGAGATTCCACCCTCCCTCTGTGG
TGGGGACTCTGGGAAGTGCTGCTGCTGCGTCCAAGTTTCTGGGGCTCAGCTTGACAAAGTGCCGCGAGGC
ATTGGCTATTGCTGTTTCCCACGCAGGGGCACCCATAGCGAACGCTGCCACTCAGACTAAGCCCCTTCAT
ATTGGCAATGCAGCCAAGCATGGGATGGAAGCCACGTTTCTGGCAATGCTGGGCCTCCAAGGAAACAAAC
AGATCTTGGACCTGGGGTCAGGGTTCGGTGCCTTCTATGCCAACTACTCCCCCGAAGACCTTCCAAGCCT
GGATTCTCACATCTGGCTGTTGGACCAGCAGGATGTGGCCTTTAAGAGCTTCCCGGCACATCTGGCTACC
CACTGGGTGGCAGATGCAGCTGCAGCCGTGAGAAAGCACCTTGTGACACCAGAAAGAGCCCTGTTCCCTG
CTGACCACATCGAGAGAATCGTGCTCAGGATCCCTGACGTCCAGTACGTAAACAGGCCCTTCCCGGACTC
AGAGCATGAAGCCCGTCATTCTTTCCAGTATGTGGCCTGTGCCTCGCTGCTCGACGGTAGCATCACTGTC
CCATCCTTCCACAGCCAGCAGGTCAATAGGCCTCAGGTGAGAGAGTTGCTCAAGAAGGTGAAGCTGGAGC
ATCCTCCTGACAACCCGCCAAGCTTCGACACGCTATACTGTGAAATAAGCATCACTCTAAAGGACGGGAC
CACTTTCACCGAGCGCTCTGACACCTTCTATGGTCACTGGAGGAAACCACTGAGCCAGGAAGATCTGCGC
AACAAGTTCCGAGCCAATGCCTCAAAGATGCTATGCAGGGACACGGTGGAAAGCCTTATAACGGTAGTAG
AAAAGCTAGAAGACCTAGAAGACTGCTCTGTGCTAACCAGACTTCTGAAAGGACCCTCTGTCCAAGATGA
AGCTTCAAAACTATCCAGCATGTCCTCATTCGATCACACAACGTTGCCCAGGTTTACCAATATCTAA


Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_008392
Insert Size 1467 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008392.1, NP_032418.1
RefSeq Size 2588 bp
RefSeq ORF 1467 bp
Locus ID 16365
UniProt ID P54987
Cytogenetics 14 51.67 cM
Summary Involved in the inhibition of the inflammatory response. Acts as a negative regulator of the Toll-like receptors (TLRs)-mediated inflammatory innate response by stimulating the tumor necrosis factor alpha-induced protein TNFAIP3 expression via reactive oxygen species (ROS) in LPS-tolerized macrophages. Involved in antimicrobial response of innate immune cells; ACOD1-mediated itaconic acid production contributes to the antimicrobial activity of macrophages. Plays a role in the embryo implantation.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Acod1 (NM_008392) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG217265 Irg1 (tGFP-tagged) - Mouse immunoresponsive gene 1 (Irg1), (10ug) 10 ug
$886.00
MR217265 Irg1 (Myc-DDK-tagged) - Mouse immunoresponsive gene 1 (Irg1) 10 ug
$686.00
MR217265L3 Lenti ORF clone of Irg1 (Myc-DDK-tagged) - Mouse immunoresponsive gene 1 (Irg1) 10 ug
$986.00
MR217265L4 Lenti ORF clone of Irg1 (mGFP-tagged) - Mouse immunoresponsive gene 1 (Irg1) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.