Slc39a8 (NM_026228) Mouse Untagged Clone

CAT#: MC216320

Slc39a8 (untagged) - Mouse solute carrier family 39 (metal ion transporter), member 8 (Slc39a8), transcript variant 3, (10ug)

USD 598.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc39a8 (NM_026228) Mouse Untagged Clone
Symbol Slc39a8
Synonyms 4933419D20Rik; AA986696; BIGM103; ZIP-8; Zip8
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216320 representing NM_026228
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCCGGGCCGGGCAGTGGCCGGGCTGCTGCTGCTGGCGGCCACCAGCCTGGGACACCCCTCGGAGG
GACCGGAGCTCGCCTTCAGTGAGGATGTGCTGAGCGTGTTCGGCGCCAACCGGAGCCTGTCGGCCGCGCA
GCTGGGGCGCCTGCTGGAGCGTCTGGGGGCTGCATCCCAGCAGGGAGCGCTGGACCTGGGCCAGCTGCAC
TTCAACCAGTGTTTGTCAGCAGAAGACATCTTTTCTCTTCATGGTTTCTCAAATGTCACCCAGATAACCA
GCTCGAACTTCTCTGCCATCTGCCCCGCGATCTTACAGCAGCTGAACTTCCATCCCTGCGAGGATCTAAG
AAAGCACAACGCAAAGCCCAGTCTTTCCGAAGTCTGGGGCTATGGATTCCTGTCAGTGACAATTATCAAT
CTGGCCTCTCTCCTGGGATTGATTTTAACCCCCTTGATAAAGAAGTCTTATTTCCCCAAGATTTTAACTT
ATTTCGTGGGACTCGCTATTGGGACTCTTTTCTCAAACGCCATTTTCCAGCTTATTCCAGAGGCATTTGG
ATTTAATCCCAAAATTGACAATTACGTTGAGAAAGCAGTTGCTGTGTTTGGTGGATTTTACATGCTTTTC
TTTGTCGAGAGAACACTTAAGATGCTACTGAAAACATATGGCCAGAATGACCATACTCACTTCAGGAATG
ATGACTTTGGTTCTAAAGAAAAAACCCACCAACCCAAAACGTTACCATTGCCTGCAGTCAACGGTGTGAC
TTGCTATGCCAACCCCGCTGTCACTGAGCCTAACGGACACATCCACTTCGACACTGTCAGCGTTGTATCC
CTCCAGGATGGAAAAACAGAGCCAAGCTCATGTACCTGTCTGAAGGGGCCCAAACTGTCAGAAATAGGAA
CAATTGCCTGGATGATCACGCTTTGTGATGCCCTCCACAATTTCATCGACGGCTTGGCGATTGGGGCATC
TTGTACTTTGTCTCTTCTTCAGGGGCTCAGTACGTCCATAGCGATCCTGTGTGAGGAGTTTCCTCATGAG
TTAGGGGACTTTGTGATCTTGCTCAATGCAGGAATGAGCACCCGGCAAGCCTTGCTGTTCAACTTCCTCT
CCGCGTGTTCCTGCTACGTGGGACTAGCTTTCGGCATTTTGGTGGGCAACAATTTTGCTCCCAATATTAT
ATTTGCACTCGCTGGAGGCATGTTCCTCTACATTTCTCTGGCAGATATGTTTCCAGAGATGAACGACATG
CTGAGAGAAAAAGTAACTGGAAGACAAACGGATTTCACCTTCTTCATGATCCAGAATGCAGGGATGTTAA
CCGGCTTCACTGCCATCCTGCTCATCACCTTGTACGCAGGAGACATCGAATTGCAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_026228
ORF Size 1389 bp
Insert Size 1389
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_026228.5, NP_080504
RefSeq Size 3492
RefSeq ORF 1389
Locus ID 67547
Cytogenetics 3 G3|3 63.04 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.