Myc (NM_010849) Mouse Untagged Clone

SKU
MC216121
Myc (untagged) - Mouse myelocytomatosis oncogene (Myc), transcript variant 1, (10ug)
  $457.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Myc
Synonyms AU016757; bHLHe3; bHLHe39; Myc2; N; Niard; Nird
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216121 representing NM_010849
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

CTGGATTTCCTTTGGGCGTTGGAAACCCCGCAGACAGCCACGACGATGCCCCTCAACGTGAACTTCACCA
ACAGGAACTATGACCTCGACTACGACTCCGTACAGCCCTATTTCATCTGCGACGAGGAAGAGAATTTCTA
TCACCAGCAACAGCAGAGCGAGCTGCAGCCGCCCGCGCCCAGTGAGGATATCTGGAAGAAATTCGAGCTG
CTTCCCACCCCGCCCCTGTCCCCGAGCCGCCGCTCCGGGCTCTGCTCTCCATCCTATGTTGCGGTCGCTA
CGTCCTTCTCCCCAAGGGAAGACGATGACGGCGGCGGTGGCAACTTCTCCACCGCCGATCAGCTGGAGAT
GATGACCGAGTTACTTGGAGGAGACATGGTGAACCAGAGCTTCATCTGCGATCCTGACGACGAGACCTTC
ATCAAGAACATCATCATCCAGGACTGTATGTGGAGCGGTTTCTCAGCCGCTGCCAAGCTGGTCTCGGAGA
AGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCACCAGCCTGAGCCCCGCCCGCGGGCACAGCGTCTG
CTCCACCTCCAGCCTGTACCTGCAGGACCTCACCGCCGCCGCGTCCGAGTGCATTGACCCCTCAGTGGTC
TTTCCCTACCCGCTCAACGACAGCAGCTCGCCCAAATCCTGTACCTCGTCCGATTCCACGGCCTTCTCTC
CTTCCTCGGACTCGCTGCTGTCCTCCGAGTCCTCCCCACGGGCCAGCCCTGAGCCCCTAGTGCTGCATGA
GGAGACACCGCCCACCACCAGCAGCGACTCTGAAGAAGAGCAAGAAGATGAGGAAGAAATTGATGTGGTG
TCTGTGGAGAAGAGGCAAACCCCTGCCAAGAGGTCGGAGTCGGGCTCATCTCCATCCCGAGGCCACAGCA
AACCTCCGCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACTCACCAGCACAACTACGCCGCACC
CCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAGCAG
ATCAGCAACAACCGCAAGTGCTCCAGCCCCAGGTCCTCAGACACGGAGGAAAACGACAAGAGGCGGACAC
ACAACGTCTTGGAACGTCAGAGGAGGAACGAGCTGAAGCGCAGCTTTTTTGCCCTGCGTGACCAGATCCC
TGAATTGGAAAACAACGAAAAGGCCCCCAAGGTAGTGATCCTCAAAAAAGCCACCGCCTACATCCTGTCC
ATTCAAGCAGACGAGCACAAGCTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAAC
ACAAACTCGAACAGCTTCGAAACTCTGGTGCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_010849
Insert Size 1365 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC138931, AAI38932
RefSeq Size 1489 bp
RefSeq ORF 1365 bp
Locus ID 17869
Cytogenetics 15 26.19 cM
Summary The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2010
Transcript Variant: This variant (1) represents the longer transcript and encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (a, also known as c-Myc 1) is derived from a non-AUG (CUG) start codon, while a shorter isoform (b, also known as c-Myc 2) is derived from a downstream AUG start codon. The longer isoform (a) is represented in this RefSeq. CCDS Note: This CCDS ID represents the longest c-Myc isoform, also known as c-Myc 1. Evidence in the literature, including in PMIDs 1628829, 3277717 and 9032273, shows that the transcript can produce multiple isoforms due to the use of alternative translation initiation codons. This transcript variant is supported by several transcripts, including the long mRNAs X01023.1, AK145084.1 and BC138932.1. This isoform initiates translation at a non-AUG (CUG) start codon that is well-conserved. Alternative translation initiation at a downstream AUG start codon also produces a shorter isoform, known as c-Myc 2. The shorter isoform is represented by CCDS 49615.1.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010849" in other vectors (4)
SKU Description Size Price
MG227353 Myc (tGFP-tagged) - Mouse myelocytomatosis oncogene (Myc) transcript variant 1, (10ug) 10 ug
$489.00 $657.00
MR227353 Myc (Myc-DDK-tagged) - Mouse myelocytomatosis oncogene (Myc), transcript variant 1 10 ug
$289.00 $457.00
MR227353L3 Lenti ORF clone of Myc (Myc-DDK-tagged) - Mouse myelocytomatosis oncogene (Myc), transcript variant 1 10 ug
$757.00
MR227353L4 Lenti ORF clone of Myc (mGFP-tagged) - Mouse myelocytomatosis oncogene (Myc), transcript variant 1 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products