Gata4 (NM_008092) Mouse Untagged Clone

SKU
MC215787
Gata4 (untagged) - Mouse GATA binding protein 4 (Gata4), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gata4
Synonyms Gata-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC215787 representing NM_008092
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACCAAAGCCTGGCCATGGCCGCCAACCACGGCCCCCCGCCCGGCGCCTACGAAGCAGGTGGCCCTG
GCGCCTTCATGCACAGCGCGGGCGCCGCGTCCTCGCCCGTCTACGTGCCCACTCCGCGGGTGCCGTCCTC
TGTGCTGGGCCTGTCCTACCTGCAGGGCGGTGGCAGTGCCGCTGCAGCTGGAACCACCTCGGGTGGCAGC
TCCGGGGCCGGCCCGTCGGGTGCGGGGCCTGGGACCCAGCAGGGTAGCCCTGGCTGGAGCCAAGCTGGAG
CCGAGGGAGCCGCCTACACCCCGCCGCCCGTGTCCCCGCGCTTCTCTTTCCCGGGGACTACTGGGTCCCT
GGCGGCCGCTGCCGCCGCTGCCGCAGCCCGGGAAGCTGCAGCCTACGGCAGTGGCGGCGGGGCGGCGGGC
GCTGGTCTGGCTGGCCGAGAGCAGTACGGGCGTCCGGGCTTCGCCGGCTCCTACTCCAGCCCCTACCCAG
CCTACATGGCCGACGTGGGAGCATCCTGGGCCGCAGCCGCTGCCGCCTCTGCCGGCCCCTTCGACAGCCC
AGTCCTGCACAGCCTGCCTGGACGGGCCAACCCTGGAAGACACCCCAATCTCGATATGTTTGATGACTTC
TCAGAAGGCAGAGAGTGTGTCAATTGTGGGGCCATGTCCACCCCACTCTGGAGGCGAGATGGGACGGGAC
ACTACCTGTGCAATGCCTGTGGCCTCTATCACAAGATGAACGGCATCAACCGGCCCCTCATTAAGCCTCA
GCGCCGCCTGTCCGCTTCCCGCCGGGTAGGCCTCTCCTGTGCCAACTGCCAGACTACCACCACCACGCTG
TGGCGTCGTAATGCCGAGGGTGAGCCTGTATGTAATGCCTGCGGCCTCTACATGAAGCTCCATGGGGTTC
CCAGGCCTCTTGCAATGCGGAAGGAGGGGATTCAAACCAGAAAACGGAAGCCCAAGAACCTGAATAAATC
TAAGACGCCAGCAGGTCCTGCTGGTGAGACCCTCCCTCCCTCCAGTGGTGCCTCCAGCGGTAACTCCAGC
AATGCCACTAGCAGCAGCAGCAGCAGTGAAGAGATGCGCCCCATCAAGACAGAGCCCGGGCTGTCATCTC
ACTATGGGCACAGCAGCTCCATGTCCCAGACATTCAGT:ACTGTGTCCGGCCACGGGCCCTCCATCCATC
CAGTGCTGTCTGCTCTGAAGCTGTCCCCACAAGGCTATGCATCTCCTGTCACTCAGACATCGCAGGCCAG
CTCCAAGCAGGACTCTTGGAACAGCCTGGTCCTGGCTGACAGTCATGGGGACATAATCACCGCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_008092
Insert Size 1326 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC137824, AAI37825
RefSeq Size 2299 bp
RefSeq ORF 1326 bp
Locus ID 14463
UniProt ID Q08369
Cytogenetics 14 33.24 cM
Summary Transcriptional activator that binds to the consensus sequence 5'-AGATAG-3' and plays a key role in cardiac development (By similarity). In cooperation with TBX5, it binds to cardiac super-enhancers and promotes cardiomyocyte gene expression, while it downregulates endocardial and endothelial gene expression (By similarity). Involved in bone morphogenetic protein (BMP)-mediated induction of cardiac-specific gene expression (By similarity). Binds to BMP response element (BMPRE) DNA sequences within cardiac activating regions (By similarity). Acts as a transcriptional activator of ANF in cooperation with NKX2-5 (PubMed:9584153). Promotes cardiac myocyte enlargement (By similarity). Required during testicular development (By similarity). May play a role in sphingolipid signaling by regulating the expression of sphingosine-1-phosphate degrading enzyme, spingosine-1-phosphate lyase (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame donor splice site in the central coding region compared to variant 1. The encoded isoform (2) is one amino acid shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Gata4 (NM_008092) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227022 Gata4 (tGFP-tagged) - Mouse GATA binding protein 4 (Gata4), (10ug) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
MR227022 Gata4 (Myc-DDK-tagged) - Mouse GATA binding protein 4 (Gata4) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR227022L3 Lenti ORF clone of Gata4 (Myc-DDK-tagged) - Mouse GATA binding protein 4 (Gata4) 10 ug
$757.00
MR227022L4 Lenti ORF clone of Gata4 (mGFP-tagged) - Mouse GATA binding protein 4 (Gata4) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.