Msmp (NM_001099314) Mouse Untagged Clone

SKU
MC215508
Msmp (untagged) - Mouse microseminoprotein, prostate associated (Msmp), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Msmp
Synonyms OTTMUSG00000007017; Psmp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC215508 representing NM_001099314
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCTAAGGATGCTCTGGGCTGGCCAAGCCAAGGGGATCCTCGGAGGCTGGAGGACCATCTGCTTGG
TGGTGTCTCTGTTCCTACAGCACCCGGGAGTTAGCAGCAAGTGTTACTTCCAAGCTCAAGCTCCCTGCCA
CTACGAGGGTAAATACTTCACTCTGGGTGAATCTTGGCTCCGCAAGGACTGTTTCCATTGTACCTGTCTG
CATCCTGTTGGTGTGGGCTGCTGTGACACGGCTCAGCATCCTATTGACTTCCCTGCTGAGTGTGAAGTGC
TACAGGAGGCAGGAACCTGTCAATTTTCCCTGGTGCAGAAAGCTGACCCTCGGCTGCCCTGCAAAGGGGG
AGGGCCCGACTTAGAATGGGGCTCGGCTAACACCCCTGCTCCTGGGGCTTCTGCCCCCCACTCCAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001099314
Insert Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001099314.1, NP_001092784.1
RefSeq Size 743 bp
RefSeq ORF 420 bp
Locus ID 100039672
UniProt ID B1AWI6
Cytogenetics 4 A5
Summary Acts as a ligand for C-C chemokine receptor CCR2 (By similarity). Signals through binding and activation of CCR2 and induces a strong chemotactic response and mobilization of intracellular calcium ions (By similarity). Exhibits a chemotactic activity for monocytes and lymphocytes but not neutrophils (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001099314" in other vectors (4)
SKU Description Size Price
MG217819 Msmp (tGFP-tagged) - Mouse microseminoprotein prostate associated (Msmp), (10ug) 10 ug
$350.00
MR217819 Msmp (Myc-DDK-tagged) - Mouse microseminoprotein, prostate associated (Msmp) 10 ug
$289.00
MR217819L3 Lenti ORF clone of Msmp (Myc-DDK-tagged) - Mouse microseminoprotein, prostate associated (Msmp) 10 ug
$450.00
MR217819L4 Lenti ORF clone of Msmp (mGFP-tagged) - Mouse microseminoprotein, prostate associated (Msmp) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products