Mymx (NM_001177470) Mouse Untagged Clone

SKU
MC215329
Gm7325 (untagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 3, (10ug)
$165.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mymx
Synonyms EG653016; Esgp; Gm7325; minion; myomerger
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC215329 representing NM_001177470
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGAAGAAAGCTGCACTGTAAAACTAATCCAGTTGAAAACTGGGGAGTACAGAGGTGCAGGTCCTG
CCATGCCCGTTCCATTGCTCCCGATGGTGCTTCGATCGCTGCTGTCCCGCCTGCTGCTGCCTGTTGCCCG
CCTGGCCCGGCAGCACCTCCTGCCCTTGCTGCGCCGGCTGGCCCGCCGACTGAGCTCCCAAGACATGAGA
GAGGCTCTGCTGAGCTGTCTGCTCTTTGTCCTCAGCCAGCAACAGCCACCGGATTCTGGAGAGGCCTCCA
GAGTGGACCACTCCCAGAGGAAGGAGAGATTGGGCCCCCAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001177470
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001177470.1, NP_001170941.1
RefSeq Size 852 bp
RefSeq ORF 327 bp
Locus ID 653016
UniProt ID Q2Q5T5
Cytogenetics 17 B3
Summary Myoblast-specific protein that mediates myoblast fusion, an essential step for the formation of multi-nucleated muscle fibers (PubMed:28386024, PubMed:28569745, PubMed:28569755, PubMed:30197239). Involved in membrane fusion downstream of the lipid mixing step mediated by MYMK (PubMed:30197239). Acts by generating membrane stresses via its extracellular C-terminus, leading to drive fusion pore formation (PubMed:30197239). Acts independently of MYMK (PubMed:30197239). Involved in skeletal muscle regeneration in response to injury by mediating the fusion of satellite cells, a population of muscle stem cells, with injured myofibers (PubMed:29581287).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate 5' terminal exon compared to variant 1, resulting in translation initiation from an in-frame upstream AUG and a longer isoform (2) with a distinct N-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:Mymx (NM_001177470) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG224234 Gm7325 (tGFP-tagged) - Mouse predicted gene 7325 (Gm7325) transcript variant 3, (10ug) 10 ug
$489.00
MR224234 Gm7325 (Myc-DDK-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 3 10 ug
$289.00
MR224234L3 Lenti ORF clone of Gm7325 (Myc-DDK-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 3 10 ug
$450.00
MR224234L4 Lenti ORF clone of Gm7325 (mGFP-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 3 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.