Opn5 (NM_181753) Mouse Untagged Clone

SKU
MC214652
Opn5 (untagged) - Mouse opsin 5 (Opn5), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Opn5
Synonyms Gpr136; Neuropsin; PGR12; TMEM13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214652 representing NM_181753
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTTGAACCACACTGCCCTACCTCAGGATGAGCGCCTGCCCCACTATCTTCGAGACGAGGACCCTT
TTGCTTCCAAACTTTCCTGGGAAGCGGATTTAGTGGCTGGCTTTTACCTAACAATAATCGGGATTCTCTC
TACATTTGGAAATGGGTATGTCCTTTATATGTCTTCTAGACGCAAGAAGAAGCTGAGACCTGCGGAAATA
ATGACTATCAATTTAGCAGTCTGTGATCTGGGGATATCAGTTGTAGGCAAGCCGTTCACCATCATCTCTT
GCTTCTGCCACCGCTGGGTGTTTGGCTGGTTTGGCTGCCGCTGGTATGGCTGGGCTGGATTTTTCTTTGG
CTGTGGAAGCCTGATTACCATGACTGCTGTCAGCCTGGACCGCTATCTGAAGATCTGTTATCTGTCTTAT
GGGGTCTGGCTGAAGAGAAAGCATGCCTACATCTGCCTGGCAGTCATCTGGGCTTATGCTTCCTTCTGGA
CCACCATGCCCTTGGTGGGCCTGGGGGACTATGCACCTGAGCCCTTCGGAACCTCATGCACCCTGGACTG
GTGGCTGGCCCAGGCTTCAGGTGGGGGTCAGGTGTTCATCCTGAGCATCCTCTTCTTCTGCCTCCTGCTG
CCAACGGCTGTGATTGTTTTCTCATATGCTAAGATCATCGCCAAGGTGAAGTCTTCTTCTAAAGAGGTAG
CCCATTTCGACAGTCGAATCCATAGCAGCCATGTACTTGAGGTGAAGCTGACCAAGGTGGCAATGCTGAT
TTGTGCTGGTTTCCTGATTGCCTGGATTCCTTATGCGGTCGTCTCTGTGTGGTCAGCTTTTGGAAGGCCA
GACTCCATCCCCATACAGCTCTCCGTGGTGCCCACACTCCTTGCAAAATCAGCAGCGATGTACAATCCAA
TCATCTACCAGGTCATTGATTACAGATTTGCCTGTTGCCAGGCTGGTGGTTTGAGAGGAACGAAGAAGAA
ATCTTTGGAAGACTTTAGGCTGCATACTGTAACCGCAGTCAGGAAGTCTTCTGCTGTGCTGGAGATCCAT
CCAGAGAGCAGTTCCAGATTTACTAGTGCCCATGTTATGGATGGAGAGAGTCACAGTAATGATGGTGACT
GTGGCAAGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_181753
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181753.4, NP_861418.2
RefSeq Size 1824 bp
RefSeq ORF 1134 bp
Locus ID 353344
UniProt ID Q6VZZ7
Cytogenetics 17 B3
Summary G-protein coupled receptor which selectively activates G(i) type G proteins via ultraviolet A (UVA) light-mediated activation in the retina (PubMed:22043319). Preferentially binds the chromophore 11-cis retinal and is a bistable protein that displays emission peaks at 380 nm (UVA light) and 470 nm (blue light) (PubMed:22043319, PubMed:31607531). Required for the light-response in the inner plexiform layer, and contributes to the regulation of the light-response in the nerve fiber layer, via phosphorylated DAT/SLC6A3 dopamine uptake (PubMed:30936473). Involved in local corneal and retinal circadian rhythm photoentrainment via modulation of the UVA light-induced phase-shift of the retina clock (PubMed:26392540, PubMed:30240620). Acts as a circadian photoreceptor in the outer ear and vibrissal pads, via modulation of circadian clock-gene expression in response to violet light during the light-to-dark transition phase and night phase of the circadian cycle (PubMed:31607531). Required in the retina to negatively regulate hyaloid vessel regression during postnatal development via light-dependent OPN5-SLC32A1-DRD2-VEGFR2 signaling (PubMed:30936473). Involved in the light-dependent regulation of retina and vitreous compartment dopamine levels (PubMed:30936473).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Opn5 (NM_181753) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG224963 Opn5 (tGFP-tagged) - Mouse opsin 5 (Opn5), (10ug) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
MR224963 Opn5 (Myc-DDK-tagged) - Mouse opsin 5 (Opn5) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR224963L3 Lenti ORF clone of Opn5 (Myc-DDK-tagged) - Mouse opsin 5 (Opn5) 10 ug
$757.00
MR224963L4 Lenti ORF clone of Opn5 (mGFP-tagged) - Mouse opsin 5 (Opn5) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.