Zfp703 (NM_001110508) Mouse Untagged Clone

SKU MC214649

Zfp703 (untagged) - Mouse zinc finger protein 703 (Zfp703), transcript variant 2, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Zfp703
• Synonyms: 1110032O19Rik; AI430822; AL022941; Csmn1; End2; Zeppo1; Znf703; Zpo1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214649 representing NM_001110508; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGAGCGATTCGCCCGCTGGATCTAACCCAAGGACACCCGAAAGCAGCGGCAGCGGCGGCGGCAGCAGCA; GCGGCGGCGGCGGCGGGAAGAGGCCGGCGGTGCCGGCAGTGGTGTCCCTCCTGCCCCCGGCGGACCCCCT; GCGCCAGGCGAACCGGCTCCCTATCAGGGTCCTGAAGATGCTGAGCGCTCACACCGGTCACCTCCTGCAC; CCGGAGTACCTGCAACCGCTGTCCTCCACACCCGTCAGCCCAATTGAGATGGGAAAATTATCTGGAAAGG; GGCGAATCACCATCCGGATTACAGAGAAGTCACCTTTAACCGGGAGGGCTGTGGTTGAGCCATTTCTCCT; GCGCGCCAGCGCCCATGTCACACTCGGGGACTAA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110508
• Insert Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001110508.1, NP_001103978.1
• RefSeq Size: 3320 bp
• RefSeq ORF: 384 bp
• Locus ID: 353310
• Cytogenetics: 8 A2
• Summary: Transcriptional corepressor which does not bind directly to DNA and may regulate transcription through recruitment of histone deacetylases to gene promoters. Regulates cell adhesion, migration and proliferation. May be required for segmental gene expression during hindbrain development.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) contains an additional exon compared to transcript variant 1. This causes a frame-shift and early translation termination, resulting in a shorter isoform (2) with a different C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript from the reference strain (C57BL/6J) was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.