Fam19a1 (NM_182808) Mouse Untagged Clone

SKU
MC214451
Fam19a1 (untagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1), (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fam19a1
Synonyms C630007B19Rik; FAM19A1 TAFA-1; Tafa-1; TAFA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214451 representing NM_182808
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAATGGTCTCTGCAATGTCCTGGGCCCTGTACTTGTGGATAAGTGCTTGTGCGATGCTGCTCTGCC
ATGGGTCACTCCAACACACCTTCCAGCAGCATCACCTGCACCGGCCAGAAGGAGGGACCTGTGAAGTGAT
CGCGGCCCACAGGTGTTGTAACAAGAACCGCATCGAGGAGCGGTCACAAACAGTGAAGTGTTCCTGTTTA
CCTGGGAAAGTGGCTGGGACAACAAGAAACCGACCTTCCTGTGTGGATGCCTCCATAGTAATTGGGAAAT
GGTGGTGTGAGATGGAGCCCTGCCTAGAAGGAGAAGAATGTAAGACACTCCCTGACAATTCTGGATGGAT
GTGTGCTACAGGCAACAAGATTAAGACTACACGAATTCACCCAAGAACCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_182808
Insert Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182808.3, NP_877960.1
RefSeq Size 3252 bp
RefSeq ORF 402 bp
Locus ID 320265
UniProt ID Q7TPG8
Cytogenetics 6 D3
Summary This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Fam19a1 (NM_182808) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG213089 Fam19a1 (tGFP-tagged) - Mouse family with sequence similarity 19 member A1 (Fam19a1), (10ug) 10 ug
$350.00
MR213089 Fam19a1 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) 10 ug
$289.00
MR213089L3 Lenti ORF clone of Fam19a1 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) 10 ug
$450.00
MR213089L4 Lenti ORF clone of Fam19a1 (mGFP-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.