Olfr1255 (NM_146977) Mouse Untagged Clone

SKU
MC214102
Olfr1255 (untagged) - Mouse olfactory receptor 1255 (Olfr1255), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Olfr1255
Synonyms MOR232-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214102 representing NM_146977
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATGACACTGAACACATGGAGAATAAAAGGAACGTGACTGAGTTCATCTTGATAGGTCTTACACAGA
ACCCCCAAATGCAGAAAGTAGTGTTCGTGACATTTTTGCTTCTGTACATGATAACAATTTCAGGCAACCT
GCTCATTGTGGTCACTGTCATCAACAGCCAGGCTCTGAATTCCCCCATGTATTTCTTCCTGAGCCACCTC
TCCTTGATAGATACAATTTACACCTCTTCTTCAGCTCCAAAGCTGATTGCGGACTCCCTTCAAGAGAACA
AAGTCATCTCCTTTAATGGATGCATGGCTCAAGTCTATGCAGAGCACATTTTTGGTGCTACTGAGATCAT
CCTGTTGACAGTGATGGCTTATGACCGCTATGTGGCCATCTGCAAACCTCTGCACTATATGACCATCATG
AGCCACAAGCTATGCATTCTCCTGGTGGGGGTAGCCTGGACTGGAGGATTTCTCCATGCAACTATTCAGA
TCCTTTTTACAGTGTGGCTGCCCTTCTGTGGCCCCAACATCATAGACCATTTTATGTGTGACTTGTACCC
ATTGTTGGAACTTGTTTGCATGGACACACACACTCTTGGTCTCTTTGTTGCTGCCAACAGTGGGTTCATC
TGCCTATTTAATTTCCTGCTCTTGATGGGATCCTATGTGATCATCTTGCGCTCTTTAAAGAACTATAGCT
TAGAAGGCAGGCGCAAAGCTCTCTCCACCTGTGTGTCACACATCACAGTAGTTGTTTTATCCTTTATTCC
TTGCATATTTGTATATCTACGTCCAGTGACCACTCTGCCAATTGATAAAGCTGTTGCAGTCTTTTATACT
TTGGTGGCCCCTCTACTGAATCCTTTAATCTACACCCTCAGAAATTCTGAGGTAAAAAATGCAATAAAGA
AGCTCTGGAGGAAAAAAATATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_146977
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_146977.2, NP_667188.2
RefSeq Size 933 bp
RefSeq ORF 933 bp
Locus ID 258979
Cytogenetics 2 E1
Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Olfr1255 (NM_146977) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG215557 Olfr1255 (tGFP-tagged) - Mouse olfactory receptor 1255 (Olfr1255), (10ug) 10 ug
$500.00
MR215557 Olfr1255 (Myc-DDK-tagged) - Mouse olfactory receptor 1255 (Olfr1255) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR215557L3 Lenti ORF clone of Olfr1255 (Myc-DDK-tagged) - Mouse olfactory receptor 1255 (Olfr1255) 10 ug
$600.00
MR215557L4 Lenti ORF clone of Olfr1255 (mGFP-tagged) - Mouse olfactory receptor 1255 (Olfr1255) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.