Ostn (NM_198112) Mouse Untagged Clone

SKU
MC213087
Ostn (untagged) - Mouse osteocrin (Ostn), (10ug)
  $165.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ostn
Synonyms Ostc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC213087 representing NM_198112
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGACTGGAGATTGGCAAGTACACACTTCATCCTGGCTATGATTGTGATGCTGTGGGGCTCAGGAA
AGGCATTCTCTGTGGACTTAGCATCACAGGAGTTTGGAACAGCAAGCTTGCAGTCTCCACCCACAGCCAG
AGAAGAGAAGTCAGCCACTGAGCTTTCGGCTAAGCTCCTGCGTCTTGATGATCTGGTGTCCTTAGAGAAT
GACGTATTTGAGACCAAGAAAAAGAGAAGCTTCTCTGGCTTTGGGTCTCCCCTTGACAGACTCTCAGCTG
GGTCTGTAGAGCATAGAGGGAAACAAAGGAAAGCAGTAGATCATTCAAAAAAGCGGTTTGGTATTCCCAT
GGATCGGATTGGTAGAAACCGGCTCTCCAGTTCCAGAGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_198112
Insert Size 393 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198112.2, NP_932780.1
RefSeq Size 1268 bp
RefSeq ORF 393 bp
Locus ID 239790
UniProt ID P61364
Cytogenetics 16 B2
Summary Hormone that acts as a ligand for natriuretic peptide receptor NPR3/NPR-C and promotes bone growth and physical endurance in muscle. Acts as a regulator of osteoblast differentiation and bone growth by binding to natriuretic peptide receptor NPR3/NPR-C, thereby preventing binding between NPR3/NPR-C and natriuretic peptides, leading to increase cGMP production (PubMed:14523025, PubMed:17951249). Required to enhance physical endurance: induced following physical exercise in muscle and promotes cGMP production, probably by interacting with NPR3/NPR-C (PubMed:26668395). May act as an autocrine and paracrine factor linked to glucose metabolism in skeletal muscle (PubMed:15044443).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198112" in other vectors (4)
SKU Description Size Price
MG215395 Ostn (tGFP-tagged) - Mouse osteocrin (Ostn), (10ug) 10 ug
$425.00
MR215395 Ostn (Myc-DDK-tagged) - Mouse osteocrin (Ostn) 10 ug
$225.00
MR215395L3 Lenti ORF clone of Ostn (Myc-DDK-tagged) - Mouse osteocrin (Ostn) 10 ug
$525.00
MR215395L4 Lenti ORF clone of Ostn (mGFP-tagged) - Mouse osteocrin (Ostn) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products