Fam109a (NM_175474) Mouse Untagged Clone

SKU
MC212925
Fam109a (untagged) - Mouse family with sequence similarity 109, member A (Fam109a), (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fam109a
Synonyms A230106M15Rik; AU017694; IPIP27A; Ses1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212925 representing NM_175474
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTCAACGAGCGCAGCTTGGCCTTCTACGCAACCTGCGATGCCCCGGTGGACAACGCCGGCTTCC
TGTACAAGCGTGGTGGCCGTGGGACCGGCTCGCACCGGCGCTGGTTCGTGCTCCGGGGCAATATCCTCTT
TTACTTCGAGGCAGAAGGCAGCCGCGAGCCGCTGGGCGTCATCCTGCTGGAGGGCTGCACGGTGGAGCTG
GTGGATGCCCGGGAGGAGTTCGCCTTCGCAGTGCGCTTTGCCGGGGGCCGATCCCGGCCGTACGTGCTGG
CCGCTGACAGCCAGGCAGCCCTGGAGGGCTGGGTGAAGGCACTGTCCCGGGCCAGCTTCCACTATCTGCG
CTTGGTGGTGCGGGAGCTGGAACAGCAACTGGCTGCCATGCGCGAGGGAAGCCCCGCCAACGCCTTACCC
GCCAACCCGAGCCCGGTTTTGACCCAGAGACCCAAGGAGAACGGCTGGGTAGTGTGGAGCACGCTGCCCG
AGCAGCCCTCGGTAGCCCCTCAGCGGCCGCCGCCACTGCCACCCCGCCGCAGGGCCTCAGCGGCCAACGG
GCCCTTGGCATCCTTCGCCCAGCTGCATGCGCGATATGGACTAGAGGTGCAGGCCCTTAGGGACCAGTGG
CGCGGAGGCCAGGCTGGCCTAGCCAGCTTAGAGGTCCCCTGGCATCCTGGTTCTGCTGAGACTCAGACCC
AGGACCAGCCAGCCCTAAGGGGACATAGTGGGTGTAAGGTATTACATGTATTCCGTTCCGTAGAATGGCC
TGTTTGCAATCCAGGCTCCCAGGGGACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_175474
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175474.3, NP_780683.1
RefSeq Size 2335 bp
RefSeq ORF 801 bp
Locus ID 231717
UniProt ID Q8BH49
Cytogenetics 5 F
Summary Plays a role in endocytic trafficking. Required for receptor recycling from endosomes, both to the trans-Golgi network and the plasma membrane.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.
Write Your Own Review
You're reviewing:Fam109a (NM_175474) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG221504 Fam109a (tGFP-tagged) - Mouse family with sequence similarity 109 member A (Fam109a), (10ug) 10 ug
$500.00
MR221504 Fam109a (Myc-DDK-tagged) - Mouse family with sequence similarity 109, member A (Fam109a) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR221504L3 Lenti ORF clone of Fam109a (Myc-DDK-tagged) - Mouse family with sequence similarity 109, member A (Fam109a) 10 ug
$600.00
MR221504L4 Lenti ORF clone of Fam109a (mGFP-tagged) - Mouse family with sequence similarity 109, member A (Fam109a) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.