Atp5g3 (NM_175015) Mouse Untagged Clone

SKU MC212816

Atp5g3 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), nuclear gene encoding mitochondrial protein, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Atp5g3
• Synonyms: 6030447M23; Atp5mc3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212816 representing NM_175015; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGTTCGCCTGCGCCAAGCTCGCCCGCACCCCCGCTCTGATCCGAGCTGGATCCAGAGTTGCATATAGAC; CAATTTCTGCATCAGTGTTATCTCGGCCAGAGACTAGGACTGGAGAGGGCTCTACAGTTTTTAATGGGGC; CCAGAATGGTGTGTGTCAGCTGATCCGAAGGGAGTTTCAGACCAGTGTAATCAGCAGAGACATTGATACT; GCTGCCAAATTCATTGGTGCAGGTGCTGCAACAGTAGGAGTTGCTGGTTCTGGTGCTGGTATTGGAACAG; TCTTTGGCAGTCTTATCATTGGTTATGCCAGAAACCCTTCACTGAAGCAGCAGCTGTTCTCATATGCTAT; CCTGGGATTTGCCTTGTCTGAAGCTATGGGTCTCTTTTGTTTGATGGTTGCGTTCTTGATCTTGTTTGCC; ATGTAA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_175015
• Insert Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_175015.3, NP_778180.1
• RefSeq Size: 729 bp
• RefSeq ORF: 426 bp
• Locus ID: 228033
• UniProt ID: P56384
• Cytogenetics: 2 C3
• Summary: The protein encoded by this gene is a subunit of mitochondrial membrane ATP synthase, the enzyme that catalyzes ATP synthesis during oxidative phosphorylation. This gene encodes subunit 9, which is present in multiple copies in the transmembrane part of the ATP synthase complex. Phenotype and gene expression profiles suggest correlations between this gene and alcoholism- and obesity-related phenotypes. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Sep 2014]; Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (a).