Il1f9 (NM_153511) Mouse Untagged Clone

SKU
MC212620
Il1f9 (untagged) - Mouse interleukin 1 family, member 9 (Il1f9), (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il1f9
Synonyms Il36g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212620 representing NM_153511
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAACAATGAAAAAAAAAACATTGTGTATGGAAGTGATGTTGAGATGGAACACGAGAGAGCTGGGC
TATTTGTATCTTCAGCTATGTTTTCTAAACACCCATTTTCTACACACATCTCAGGAAGAGAAACTCCTGA
CTTTGGGGAGGTTTTTGACTTGGACCAGCAGGTGTGGATCTTTCGTAATCAGGCCCTTGTGACAGTTCCA
CGAAGCCACAGAGTAACCCCAGTCAGCGTGACTATCCTCCCATGCAAGTACCCAGAGTCTCTTGAACAGG
ACAAAGGGATTGCCATTTATTTGGGAATTCAGAATCCAGATAAATGCCTGTTTTGTAAGGAAGTTAATGG
ACACCCTACTTTGCTGCTAAAGGAAGAGAAGATTTTGGATTTGTACCACCACCCTGAGCCAATGAAGCCA
TTCCTGTTTTACCACACCCGGACAGGTGGAACATCCACCTTTGAATCAGTGGCTTTCCCTGGCCACTATA
TTGCCTCCTCCAAGACTGGCAACCCCATCTTCCTCACATCAAAAAAGGGAGAATATTACAACATTAACTT
CAATTTAGATATAAAGTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_153511
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153511.3, NP_705731.2
RefSeq Size 1647 bp
RefSeq ORF 582 bp
Locus ID 215257
Cytogenetics 2 16.24 cM
Write Your Own Review
You're reviewing:Il1f9 (NM_153511) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG219429 Il1f9 (tGFP-tagged) - Mouse interleukin 1 family member 9 (Il1f9), (10ug) 10 ug
$489.00
MR219429 Il1f9 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 9 (Il1f9) 10 ug
$289.00
MR219429L3 Lenti ORF clone of Il1f9 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 9 (Il1f9) 10 ug
$450.00
MR219429L4 Lenti ORF clone of Il1f9 (mGFP-tagged) - Mouse interleukin 1 family, member 9 (Il1f9) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.