Eif2b1 (NM_145371) Mouse Untagged Clone

SKU
MC212523
Eif2b1 (untagged) - Mouse eukaryotic translation initiation factor 2B, subunit 1 (alpha) (Eif2b1), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Eif2b1
Synonyms 26kD; D5Ertd406; D5Ertd406e; EIF2; EIF2BA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212523 representing NM_145371
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGACGGTGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGGAGATCCTAAAATGGCCTCAGCTG
TGGCTGCCATCCAGACTTTGTTGGAATTCTTGAAGAGAGATAAAGGAGAAACACTCCAGGGCCTGAGAGC
AAATCTCACCTATGCCATAAAAACCCTCTGTGGTGTGGACTCCTCAGTGGCCGTGTCATCTGGCGGGGAG
CTCTTCCTTCGCTTCATCAGCCTCACCTCCCTGGAATACTCTGACTACTCCAAATGTAAGAAGATCATGA
TTGAGAGAGGAGAGCTGTTCCTGAGAAGAATATCCCTGTCGAGAAATAAGATTGCCAATCTGTGTCATAC
ATTCATCAAAGACGGGGCGAGAATTTTGACTCACGCCTACTCCAGAGTTGTCTTAAGAGTCCTGGAAGAA
GCCGTGGCAGCCAAGAAACGGTTCAGTGTGTATATCACGGAGTCGCAGCCTGATTTATCTGGTAAGAAAA
TGGCCAAAGCCCTCTCCCACCTCAACGTCCCTGTCACTGTGGTGCTGGATGCTGCTGTCGGCTATATCAT
GGAGAAAGCAGATCTTGTCATAGTTGGTGCTGAAGGAGTGGTAGAGAACGGAGGCATTATTAACAAGATT
GGAACCAACCAGATGGCCGTGTGTGCCAAAGCCCAGAATAAGCCCTTCTATGTGGTTGCAGAAAGCTTCA
AGTTCGTACGCCTCTTTCCACTCAACCAGGAGGACGTCCCAGATAAGTTTAAGTACAAGGCAGACACTCT
GAAGTCTGTGCAGACTGGGCAGGATCTCAAAGAGGAACACCCATGGGTGGACTACACCTCCCCATCCCTC
ATCACCCTGCTGTTTACGGACCTGGGTGTGTTGACGCCATCTGCTGTAAGCGATGAGCTCATCAAGCTGT
ACCTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_145371
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145371.4, NP_663346.1
RefSeq Size 2012 bp
RefSeq ORF 918 bp
Locus ID 209354
UniProt ID Q99LC8
Cytogenetics 5 63.67 cM
Summary This gene encodes the alpha subunit of the eukaryotic translation initiation factor complex 2B (eIF2B). The eIF2B complex is a heterodecamer comprised of two molecules each of alpha, beta, gamma, delta and epsilon subunits. The eIF2B complex is a critical regulator of protein synthesis acting as the guanine nucleotide exchange factor for eIF2 to enable the formation of ternary complex that is required for the initiation of mRNA translation. [provided by RefSeq, Aug 2015]
Write Your Own Review
You're reviewing:Eif2b1 (NM_145371) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204296 Eif2b1 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 2B, subunit 1 (alpha) (Eif2b1) 10 ug
$500.00
MR204296 Eif2b1 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 2B, subunit 1 (alpha) (Eif2b1) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204296L3 Lenti ORF clone of Eif2b1 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 2B, subunit 1 (alpha) (Eif2b1) 10 ug
$600.00
MR204296L4 Lenti ORF clone of Eif2b1 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 2B, subunit 1 (alpha) (Eif2b1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.