Fam228b (NM_175431) Mouse Untagged Clone

SKU
MC212491
Fam228b (untagged) - Mouse RIKEN cDNA A830093I24 gene (A830093I24Rik), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fam228b
Synonyms A830093I24Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212491 representing NM_175431
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCACAATGAAAAATAGGAGCCAAGATGATATGGTGACGGGCACACTCCCCAAGCTCAAGAGCTCCA
AAGAATGGTTGGAACCACAGTCGCTTTCTTTTATGGAGGCTTTAGCTAAAGAAGATACTGATGCAGCTGT
TCAATCAATTTTATATAGAGAAAATTATATTATGAAGGAACTAGATAAGTATTTACATCATCAAGACTTC
TTAAACACAAGAAGAAAAGAGATGCTGTATAAAAAGTGGGTTGAACGTGTGGCAGATCCTCTCCAGAAGA
AAATTATAGAAAAAGTTCATTCACATAAGAACATTAAAAAGAGGAGACGTCAAGAATTAGACAATTTTTT
GAAACATTCAAATAAGAAGGGAAATGCATTTATAGAGCATTATGATCCAAAAGAATATGATCCTTTTTAT
ATGAGCAAAGAGGACCCCAATTTTCTGAAGGTTATCATGCCACCGTTTCGTGACCCCTTGAAAAAAGCCC
AATATGACCAGGATGATGAAAAAAGAACCCTTCTGCAGTGTGAGACTGGCAAAATCTATACAATGAAAGA
ATTTAAAGAGATCGAGAAGGCCCAGTTGCATTCCAGATTCCCGAGTATTTCTAATTCAAGGCAAAGTATG
ACTCCAAATGGATGGCTTAAAGTGCCCATGAGTTATATAGAAAGTGAATTTTGTAAAAAGAGCAGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_175431
Insert Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175431.4, NP_780640.2
RefSeq Size 2886 bp
RefSeq ORF 699 bp
Locus ID 207921
UniProt ID Q497Q6
Cytogenetics 12 A1.1
Write Your Own Review
You're reviewing:Fam228b (NM_175431) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG214177 Fam228b (tGFP-tagged) - Mouse RIKEN cDNA A830093I24 gene (A830093I24Rik), (10ug) 10 ug
$500.00
MR214177 Fam228b (Myc-DDK-tagged) - Mouse RIKEN cDNA A830093I24 gene (A830093I24Rik) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR214177L3 Lenti ORF clone of Fam228b (Myc-DDK-tagged) - Mouse RIKEN cDNA A830093I24 gene (A830093I24Rik) 10 ug
$600.00
MR214177L4 Lenti ORF clone of Fam228b (mGFP-tagged) - Mouse RIKEN cDNA A830093I24 gene (A830093I24Rik) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.