Pawr (NM_054056) Mouse Untagged Clone

SKU
MC212285
Pawr (untagged) - Mouse PRKC, apoptosis, WT1, regulator (Pawr), (10ug)
$503.00
5 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pawr
Synonyms 2310001G03Rik; Par-4; PAR4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212285 representing NM_054056
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACCGGCGGCTACCGGAGCGGCGGCAGCACCACCACGGACTTCCTGGAGGAGTGGAAGGCGAAGC
GCGAGAAGATGCGCGCCAAGCAGAACCCCGCGGGCCCGGGGTCGAGCGGCGGGGATCCAGCCGCCAAGTC
CCCCGCGGGATCGCTGACCCCGACCGCGGTCGCGGGAACCTCGGAGCTCAACCACGGCCCCGCGGGCGCG
GCCGCACCTGCCGCCCCCGCGCCCGGCGCCCTGAACTGCGCTCACGGCTCGTCCACGCTGCCCCGCGCGG
CTCCCGGCTCCCGGCGGGCGGAGGACGAGTGCCCTAGCGCCGCTGCGGCCTCGGGAGCGCCTGGGTCCCG
GGGCGATGAGGAGGAGCCGGATAGCGCCCGGGAGAAGGGCCGCAGCTCGGGACCCAGCGCCAGGAAAGGC
AAGGGGCAGATCGAGAAGAGGAAGCTGCGGGAGAAGCGCCGCTCCACCGGCGTGGTCAACATCCCCGCGG
CGGAGTGCTTAGATGAGTACGAAGATGATGAAGCAGGACAGAAGGAACGGAAGCGAGAGGATGCCATCAC
CCAGCAAAACACCATCCAGAATGAAGCTGCGACCCTCCCAGATCCAGGCACATCCTACCTGCCCCAGGAC
CCGTCGAGAACAGTTCCAGGCAGATACAAAAGCACAACCAGTGCCCCAGAAGATGAAATCTCAAATAGAT
ATCCCCGAACAGACAGAAGTGGTTTCAGTAGACACAACAGAGATGCAAATGCGCCGGCTAGTTTCTCCTC
AAGTAGCACCTTGGAAAAGAGAATTGAAGATCTTGAAAAGGAAGTTGTAAGAGAAAGGCAAGAAAACCTT
CGACTTGTGAGGCTGATGCAAGATAAAGAAGAAATGATTGGGAAACTCAAGGAAGAGATCGATTTGTTAA
ATAGAGACCTAGATGACATGGAAGATGAGAACGAGCAACTAAAACAGGAAAATAAAACTCTTTTGAAGGT
TGTTGGGCAGCTGACAAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_054056
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_054056.2, NP_473397.1
RefSeq Size 1828 bp
RefSeq ORF 1002 bp
Locus ID 114774
UniProt ID Q925B0
Cytogenetics 10 D1
Summary Pro-apoptopic protein capable of selectively inducing apoptosis in cancer cells, sensitizing the cells to diverse apoptotic stimuli and causing regression of tumors in animal models. Induces apoptosis in certain cancer cells by activation of the Fas prodeath pathway and coparallel inhibition of NF-kappa-B transcriptional activity. Inhibits the transcriptional activation and augments the transcriptional repression mediated by WT1. Down-regulates the anti-apoptotic protein BCL2 via its interaction with WT1. Seems also to be a transcriptional repressor by itself. May be directly involved in regulating the amyloid precursor protein (APP) cleavage activity of BACE1 (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pawr (NM_054056) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG225079 Pawr (tGFP-tagged) - Mouse PRKC apoptosis WT1 regulator (Pawr), (10ug) 10 ug
$500.00
MR225079 Pawr (Myc-DDK-tagged) - Mouse PRKC, apoptosis, WT1, regulator (Pawr) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR225079L3 Lenti ORF clone of Pawr (Myc-DDK-tagged) - Mouse PRKC, apoptosis, WT1, regulator (Pawr) 10 ug
$600.00
MR225079L4 Lenti ORF clone of Pawr (mGFP-tagged) - Mouse PRKC, apoptosis, WT1, regulator (Pawr) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.