Arl2bp (NM_024269) Mouse Untagged Clone

SKU MC212143

Arl2bp (untagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp), transcript variant 2, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Arl2bp
• Synonyms: 1700010P10Rik; 1700027H16Rik; 6330544B05Rik; AI482273; AI849834; BART; Bart1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212143 representing NM_024269; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGCGCTCCTCCGCCTCTGATGCAGAATTTGATGCTGTGGTTGGATGTTTAGAGGACATTATTATGGATG; ATGAGTTCCAGTTATTGCAGAGAAACTTCATGGACAAGTACTACCAGGAATTTGAAGACACAGAAGAGAA; TAAACTCACCTATACACCCATTTTTAATGAATATATCTCCCTGGTAGAGAAGTACATTGAAGAGCAGTTG; CTGGAGCGTATCCCAGGCTTCAACATGGCGGCCTTCACAACCACGCTGCAGCACCACAAAGATGAGGTGG; CTGGCGACATCTTTGACATGCTGCTCACATTCACGGATTTTCTGGCTTTCAAGGAGATGTTCCTGGACTA; CAGAGCAGAAAAGGAAGGCCGAGGACTGGACTTAAGCAGCGGCTTGGTTGTGACTTCTCTGTGTAAGTCA; TCTTCTACGCCAGCTTCCCAGAACAACCTGCGGCACTAG; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_024269
• Insert Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_024269.4, NP_077231.1
• RefSeq Size: 1933 bp
• RefSeq ORF: 459 bp
• Locus ID: 107566
• UniProt ID: Q9D385
• Cytogenetics: 8 C5
• Summary: Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. May play a role as an effector of ARL2 (By similarity).[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.