Setmar (NM_178391) Mouse Untagged Clone

SKU
MC211559
Setmar (untagged) - Mouse SET domain and mariner transposase fusion gene (Setmar), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Setmar
Synonyms 5830404F24Rik; Etet2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211559 representing NM_178391
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGCGGAAGGTGTGGAGAAGCTTTCTCTCGAGATAGCAGCATCTGAGGAGGAATCTGTAGCCCCGA
CAGAACAACAAGATGTAGCGTGCGGCCTGGAGAACTTGCCTGTGAGCTTGTGGCCTTTGGGGGCGGAGCC
CAGGCCTAAACCTTTCCAGTATACTCCTGATCATGTTGCTGGACCTGGAGCAGACATTGACCCCACACAA
ATAACCTTCCCTGGATGTGCTTGCATCGAAACTCCATGTGTCCCTGGCACTTGCTCTTGTCTTCGCCATG
AGAATAACTACGATGACAATTTATGCCTTAGGGATGTGGGATCCGAAGGAAAGTACGCCAAGCCAGTTTT
TGAATGCAATGTTCTGTGCCAGTGTGGCATGCGCTGCAGAAATAGGGTGGTCCAGAATGGCCTACACTTC
CTTCTCCAGGTGTTCCAGACAGAGAAAAAAGGCTGGGGACTTCGGACTTTGGAATTTATACCCAAGGGAA
GATTTGTCTGTGAGTATGCTGGGGAGGTGTTAGGATTCTCTGAAGTGCAAAGAAGAATTCACCTACAAAC
ATCACATGACTCAAATTACATCATCGCTGTCAGAGAACACATTTACAGTGGACAGATCATGGAAACATTT
GTCGACCCTACCTACATAGGAAATATTGGGAGATTCCTCAACCATTCTTGTGAACCAAATCTGTTGATGA
TTCCTGTCCGAATTGACTCAATGGTACCCAAGCTGGCACTTTTCGCAGCCAAAGATATTTTGCCAGGAGA
AGAACTCTCTTACGACTATTCAGGAAGATTCCTTAACCAAGTAAGTAGTAAAGACAAAGAAAAGATAGAC
TGTAGCCCACCACGAAAGCCTTGTTACTGTGGGGCCCAGTCATGCACCACTTTCCTGCCCTATGACAGTT
CACTATATATGGCCCCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_178391
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178391.4, NP_848478.2
RefSeq Size 1617 bp
RefSeq ORF 930 bp
Locus ID 74729
UniProt ID Q80UJ9
Cytogenetics 6 E1
Summary This gene encodes a histone-lysine N-methyltransferase that may be involved in the methylation of histone H3. In anthropoid primates this gene is a fusion gene of a SET histone-lysine N-methyltransferase and a mariner (MAR) family transposase. In all other species this gene contains only the SET domain. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Setmar (NM_178391) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG223932 Setmar (tGFP-tagged) - Mouse SET domain and mariner transposase fusion gene (Setmar), (10ug) 10 ug
$500.00
MR223932 Setmar (Myc-DDK-tagged) - Mouse SET domain and mariner transposase fusion gene (Setmar) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR223932L3 Lenti ORF clone of Setmar (Myc-DDK-tagged) - Mouse SET domain and mariner transposase fusion gene (Setmar) 10 ug
$600.00
MR223932L4 Lenti ORF clone of Setmar (mGFP-tagged) - Mouse SET domain and mariner transposase fusion gene (Setmar) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.