Arl14 (NM_027843) Mouse Untagged Clone

SKU
MC211208
Arl14 (untagged) - Mouse ADP-ribosylation factor-like 14 (Arl14), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Arl14
Synonyms 9130014L17Rik; Arf7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211208 representing NM_027843
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTCTGCTGAATTCTAAAAACCCCCAAAGCAAGCAAGCCCACATTCTTCTCCTCGGACTTGACTCAG
CTGGGAAATCTACTCTGCTTTACCGGTTAAAGTTTGCTGAGACTCTCTCAACCATCCCAACCATCGGCTT
CAACGTGGAAATGGTCCAGCTGCAGAGCAGTCTCACACTCACCGTGTGGGATGTTGGAGGACAGGAGAAG
ATGCGAACAGTCTGGGACTGCTACTGTGAGAACGCTCAAGGGCTGATGTACGTGGTGGACTGTTCCGAAG
GCAAAAAGCGACTGGAAGACTCTCGCAAAGAGTTCAAACACATTTTGAAGAACGAGCACATCAAAAACAC
ACCGGTCGTCATACTGGCCAACAAACAGGACTTGCCGGGAGCTCTGAGCGCCGAAGACATCACCAGGATG
TTCAAGGTGAAGAAGCTGTGCAGCAACCGGAACTGGTATGTGCAACCCTGCTGTGCGGTCACTGGAGAAG
GGCTGGATGACGGGTTCAGGAAATTAACCGAGTTTCTGAAAAGCTACCGAAGGACAAGAGAGACCTTAGC
AATCTTCAAGCAGAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_027843
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027843.1, NP_082119.1
RefSeq Size 1200 bp
RefSeq ORF 579 bp
Locus ID 71619
Cytogenetics 3 E1
Write Your Own Review
You're reviewing:Arl14 (NM_027843) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG217285 Arl14 (tGFP-tagged) - Mouse ADP-ribosylation factor-like 14 (Arl14), (10ug) 10 ug
$500.00
MR217285 Arl14 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 14 (Arl14) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR217285L3 Lenti ORF clone of Arl14 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 14 (Arl14) 10 ug
$600.00
MR217285L4 Lenti ORF clone of Arl14 (mGFP-tagged) - Mouse ADP-ribosylation factor-like 14 (Arl14) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.