Pgrmc2 (NM_027558) Mouse Untagged Clone

SKU
MC211101
Pgrmc2 (untagged) - Mouse progesterone receptor membrane component 2 (Pgrmc2), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pgrmc2
Synonyms 4631434O19Rik; 5730409G06Rik; DG6; PMBP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211101 representing NM_027558
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGGTGATGGGGACGTAAAGCTAAGCACCCTGGGGAGCGGCGGGGAGAGTGGCGGCGACGGGA
GCCCGGGTGGCGCCGGAGCGACGGCGGCGAGGAGCAGTTGGGTGGCGGCGCTGCTGGCGACGGGCGGGGA
GATGCTGCTGAACGTGGCGCTGGTGGCGCTGGTGCTGCTGGGGGCCTACCGGCTGTGGGTGCGCTGGGGG
CGGCGTGGTCTGTGCTCGGGACCCGGGGCGGGCGAGGAGAGCCCGGCCGCCACGCTGCCGCGCATGAAGA
AGCGGGACTTCAGCCTGGAGCAGCTGCGCCAGTACGACGGGGCGCGCACGCCGCGCATCCTGCTCGCGGT
CAATGGGAAAGTCTTCGACGTGACCAAAGGCAGCAAGTTCTACGGCCCCGCGGGTCCATATGGCATCTTT
GCTGGCAGGGACGCCTCCAGGGGGCTGGCGACATTCTGCCTGGATAAGGATGCACTTAGAGATGAATATG
ACGACCTCTCAGATTTGAACGCAGTGCAAATGGAGAGTGTTCGAGAATGGGAAATGCAGTTTAAAGAAAA
ATATGATTATGTAGGCAGACTCCTAAAGCCAGGGGAGGAGCCATCAGAGTACACAGATGAGGAGGACACC
AAGGATCACAGTAAACAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_027558
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027558.1, NP_081834.1
RefSeq Size 3022 bp
RefSeq ORF 654 bp
Locus ID 70804
UniProt ID Q80UU9
Cytogenetics 3 B
Summary Receptor for steroids.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pgrmc2 (NM_027558) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG217476 Pgrmc2 (tGFP-tagged) - Mouse progesterone receptor membrane component 2 (Pgrmc2), (10ug) 10 ug
$500.00
MR217476 Pgrmc2 (Myc-DDK-tagged) - Mouse progesterone receptor membrane component 2 (Pgrmc2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR217476L3 Lenti ORF clone of Pgrmc2 (Myc-DDK-tagged) - Mouse progesterone receptor membrane component 2 (Pgrmc2) 10 ug
$600.00
MR217476L4 Lenti ORF clone of Pgrmc2 (mGFP-tagged) - Mouse progesterone receptor membrane component 2 (Pgrmc2) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.