Mlip (NM_027150) Mouse Untagged Clone

SKU
MC210975
Mlip (untagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik), (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mlip
Synonyms 2310046A06Rik; AI931782; CIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210975 representing NM_027150
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAATTTGGAAAGCATGAACCAGGAAGCTCACTAAAGAGGAACAAGAACTTAGAGGAGGGAGTGACGT
TTGAGTACAGTGATCATATGACCTTCAGCTCTGAGAGCAAACAAGAGAGGGTCCAGAGGATACTGGATTA
TCCGTCAGAGGTCAGTGGGAGGAATTCACAACAAAAGGAATTCAATACAAAGGAACCTCAAGGAATGCAG
AAAGGTGATCTCTTCAAAGCAGAATATGTTTTTATTGTGGATTCTGATGGGGAAGATGAAGCTACATGCA
GACAAGGTGAACAAGGCCCCCCAGGGGGACCAGGCAACATAGCTACTCGGCCCAAGTCTCTGGCTATTTC
TTCTAGTCTGGCTTCTGACGTGGTGCGTCCCAAAGTACGAGGGGCTGATCTCAAGACCTCATCACATCCT
GAAATTCCTCATGGGATAGCCCCTCAGCAAAAGCATGGGCTGGCACTAGATGAACCAGCCAGGACTGAAA
GCAACTCCAAGGCCAGCGTGTTAGACCTACCAGTGGAGCATTCTTCTGATTCTCCTTCACGGCCCCCACA
GACAATGTTGGGTTCTGAAACAATCAAAACTCCTACAACTCATCCAAGAGCAGCTGGTCGAGAAACCAAA
TACGCAAATCTTTCTTCATCATCCTCAACAGCGTCTGAGAGCCAACTGACTAAGCCTGGAGTAATTCGTC
CAGTACCTGTAAAATCCAAACTACTCCTGAGAAAGGATGAAGAAGTTTATGAGCCCAACCCTTTCAGTAA
ATACCTTGAAGACAACAGTGGCCTGTTTTCTGAGCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_027150
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027150.1, NP_081426.1
RefSeq Size 1224 bp
RefSeq ORF 810 bp
Locus ID 69642
UniProt ID Q5FW52
Cytogenetics 9 D
Summary Required for precocious cardiac adaptation to stress through integrated regulation of the AKT/mTOR pathways and FOXO1. Regulates cardiac homeostasis and plays an important role in protection against cardiac hypertrophy (PubMed:26359501, PubMed:22343712, PubMed:26436652). Acts as a transcriptional cofactor, represses transactivator activity of ISL1 and MYOCD (PubMed:22343712).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Mlip (NM_027150) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG214422 Mlip (tGFP-tagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik), (10ug) 10 ug
$500.00
MR214422 Mlip (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR214422L3 Lenti ORF clone of Mlip (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik) 10 ug
$600.00
MR214422L4 Lenti ORF clone of Mlip (mGFP-tagged) - Mouse RIKEN cDNA 2310046A06 gene (2310046A06Rik) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.