Wdfy1 (NM_027057) Mouse Untagged Clone

SKU
MC210914
Wdfy1 (untagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2, (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Wdfy1
Synonyms 1700013B03Rik; 1700120F24Rik; FENS-1; Jr1; mKIAA1435; WDF1; ZFYVE17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210914 representing NM_027057
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGAGATCCACTCCAGGCCTCAGAGCAGCCGCCCGGTGCTGCTGAGCAAGATAGAGGGCCACC
AGGACGCCGTCACCGCCGCGCTGCTCATCCCCAAGGAGGACGGCGTGATCACCGCTAGCGAGGACAGAAC
CATCCGAGTATGGCTGAAAAGAGACAGCGGCCAGTACTGGCCCAGCATCTACCACACAATGGCCTCCCCT
TGCTCTGCCATGGCATACCACCACGACAGCAGGCGGATATTTGTGGGCCAGGATAATGGGGCTGTGATGG
AATTTCACGTTTCTGAAGATTTTAATAAAATGAATTTTATCAAGACCTATCCAGCCCACCAGAACCGCGT
GTCTGCTATCATCTTCAGCCTGGCTGCCGAGTGGGTGATCAGCACTGGCCACGACAAGTGTGTGAGCTGG
ATGTGCACGCGCAGCGGGAATATGCTTGGCCGCCACTTCTTCTCGTCGTGGGCTTCCTGTTTGCAGTATC
CTTCAGAGTGCCGGACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATC
CTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_027057
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027057.3, NP_081333.1
RefSeq Size 719 bp
RefSeq ORF 564 bp
Locus ID 69368
Cytogenetics 1 C4
Summary Positively regulates TLR3- and TLR4-mediated signaling pathways by bridging the interaction between TLR3 or TLR4 and TICAM1. Promotes TLR3/4 ligand-induced activation of transcription factors IRF3 and NF-kappa-B, as well as the production of IFN-beta and inflammatory cytokines (PubMed:25736436).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks multiple exons and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:Wdfy1 (NM_027057) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG214819 Wdfy1 (tGFP-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1) transcript variant 2, (10ug) 10 ug
$530.00
MR214819 Wdfy1 (Myc-DDK-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 10 ug
$330.00
MR214819L3 Lenti ORF clone of Wdfy1 (Myc-DDK-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 10 ug
$630.00
MR214819L4 Lenti ORF clone of Wdfy1 (mGFP-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 10 ug
$630.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.