Wdfy1 (NM_027057) Mouse Untagged Clone
SKU
MC210914
Wdfy1 (untagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2, (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Wdfy1 |
Synonyms | 1700013B03Rik; 1700120F24Rik; FENS-1; Jr1; mKIAA1435; WDF1; ZFYVE17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC210914 representing NM_027057
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGGAGATCCACTCCAGGCCTCAGAGCAGCCGCCCGGTGCTGCTGAGCAAGATAGAGGGCCACC AGGACGCCGTCACCGCCGCGCTGCTCATCCCCAAGGAGGACGGCGTGATCACCGCTAGCGAGGACAGAAC CATCCGAGTATGGCTGAAAAGAGACAGCGGCCAGTACTGGCCCAGCATCTACCACACAATGGCCTCCCCT TGCTCTGCCATGGCATACCACCACGACAGCAGGCGGATATTTGTGGGCCAGGATAATGGGGCTGTGATGG AATTTCACGTTTCTGAAGATTTTAATAAAATGAATTTTATCAAGACCTATCCAGCCCACCAGAACCGCGT GTCTGCTATCATCTTCAGCCTGGCTGCCGAGTGGGTGATCAGCACTGGCCACGACAAGTGTGTGAGCTGG ATGTGCACGCGCAGCGGGAATATGCTTGGCCGCCACTTCTTCTCGTCGTGGGCTTCCTGTTTGCAGTATC CTTCAGAGTGCCGGACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATC CTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_027057 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_027057.3, NP_081333.1 |
RefSeq Size | 719 bp |
RefSeq ORF | 564 bp |
Locus ID | 69368 |
Cytogenetics | 1 C4 |
Summary | Positively regulates TLR3- and TLR4-mediated signaling pathways by bridging the interaction between TLR3 or TLR4 and TICAM1. Promotes TLR3/4 ligand-induced activation of transcription factors IRF3 and NF-kappa-B, as well as the production of IFN-beta and inflammatory cytokines (PubMed:25736436).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks multiple exons and uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG214819 | Wdfy1 (tGFP-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1) transcript variant 2, (10ug) | 10 ug |
$530.00
|
|
MR214819 | Wdfy1 (Myc-DDK-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 | 10 ug |
$330.00
|
|
MR214819L3 | Lenti ORF clone of Wdfy1 (Myc-DDK-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 | 10 ug |
$630.00
|
|
MR214819L4 | Lenti ORF clone of Wdfy1 (mGFP-tagged) - Mouse WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant 2 | 10 ug |
$630.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.