Pacrg (NM_027032) Mouse Untagged Clone

SKU
MC210892
Pacrg (untagged) - Mouse PARK2 co-regulated (Pacrg), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pacrg
Synonyms 1700008H23Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210892 representing NM_027032
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGAGGACTAAACTGCTGCCACAACAGACGTTCCAGGTGCACCAGCCTCGTTCCCTGGTTTCTG
AGGGCTTCACAGTCAAAGCCATGATGAAAAACTCAGTCGTGCGGGGTCCTCCAGTTGCAGGGGCATTTAA
AGAAAGGCCGGCCAAACCCACCACTTTCCGAAAATGTTATGAGCGAGGAGACTTCCCAATCGCCCTTGAG
CATGACTCGAAAGGAAACAAAATTGCCTGGAAGGTTGAGATTGAGAAGTTGGACTACCATCATTACCTGC
CTCTGTTTTTTGATGGGCTTTCTGAAATGACGTTTCCCTATGAGTTTTTTGCTCGGCGAGGAATCCACGA
CATGCTGGAACACGGAGGGAACAAGATTCTACCTGTCATTCCTCAGCTCATTATCCCAATAAAAAATGCC
TTGAACCTCCGAAACAGACAGATCATCTGTGTGACGCTCAAGGTTCTCCAGCATCTGGTTGTGTCTTCGG
AGATGGTGGGCGAAGCTTTGTTGCCCTACTACCGTCAGATCCTGCCAATCCTGAACATCTTTAAGAACAT
GAATGTGAACTCCGGGGATGGCATCGACTACAGCCAGCAGAAGAGGGAGAACATTGGCGACCTGATCCAG
GAGACCCTAGAAGCCTTCGAGCGCTACGGAGGGGAGGACGCCTTCATCAACATCAAATACATGGTGCCTA
CCTATGAGTCGTGCTTGCTGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_027032
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027032.2, NP_081308.1
RefSeq Size 1355 bp
RefSeq ORF 726 bp
Locus ID 69310
UniProt ID Q9DAK2
Cytogenetics 17 7.8 cM
Summary Suppresses cell death induced by accumulation of unfolded Pael receptor (Pael-R, a substrate of Parkin). Facilitates the formation of inclusions consisting of Pael-R, molecular chaperones, protein degradation molecules and itself when proteasome is inhibited (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pacrg (NM_027032) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227589 Pacrg (tGFP-tagged) - Mouse PARK2 co-regulated (Pacrg), (10ug) 10 ug
$500.00
MR227589 Pacrg (Myc-DDK-tagged) - Mouse PARK2 co-regulated (Pacrg) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR227589L3 Lenti ORF clone of Pacrg (Myc-DDK-tagged) - Mouse PARK2 co-regulated (Pacrg) 10 ug
$600.00
MR227589L4 Lenti ORF clone of Pacrg (mGFP-tagged) - Mouse PARK2 co-regulated (Pacrg) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.