Tyw5 (NM_001037742) Mouse Untagged Clone

SKU
MC210788
Tyw5 (untagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 1, (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tyw5
Synonyms 1110034B05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210788 representing NM_001037742
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAGCAGCGTCTTCCGGTACCCCGGCTGCGGGGCGTCTCCCGGGAGCAGTTCATGGAGCATCTTT
ATCCACAGAGAAAGCCTCTTGTGTTGGAAGGACTCGACTTAGGATCTTGTACAAGCAAATGGACAGTGGA
TTACCTGAGTCAAGTTGGAGGAACGAAAGAAGTGAAAATTCACGTTGCTGCAGTTCCACAGATGGACTTC
ATTAGTAAGAATTTTGTCTATAGAACTTTACCTTTTAACAAGTTGGTCCAGAGAGCAGCCGAAGAAACAC
ATAAAGAATTCTTCATTTCAGAGGATGAGAAATACTACTTACGGTCACTTGGAGAAGACCCAAGGAAGGA
TGTTGCAGACATCAGACAGCAGTTCCCATCATTAGGAGGAGATATTACATTTCCAATGTTCTTCAGAGAG
GAGCAGTTCTTTTCCAGTGTTTTTCGAATTAGTTCACCTGGATTACAGCTCTGGACTCACTATGATGTAA
TGGATAACTTTTTAATACAAGTGACAGGAAAGAAGCGAATTACACTGTTCAATCCTCGGGATGCACAATA
TTTATATTTATCAGGTTCTAAATCAGAAGTGCTGAATATCGACAGCCCAGACCTGGATAAATACCCACTC
TTTCCTAAAGCAAGGAGGTATGAGTGCTCCCTGGAAGCTGGAGATGTCCTCTTCATTCCTGCTTTATGGT
TCCATAATGTAGTTTCTGAAGAGTTTGGAGTGGGGGTGAATATCTTCTGGAAGCACCTTCCATCGGAATG
CTATGACACAACAGATACCTATGGCAACAAAGATCCTGTAGCGGCATCCAGAGCTGTGCAGATCTTGGAC
AGAGCTTTGAAAACACTGGCTGAATTACCAGAGGAATACAGGGACTTCTATGCACGCCAAATGGTCTTAC
GTATTCAAGACAAAGCCTACAGCAAGAACTTTGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001037742
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001037742.2, NP_001032831.2
RefSeq Size 1448 bp
RefSeq ORF 948 bp
Locus ID 68736
UniProt ID A2RSX7
Cytogenetics 1 C1.3
Summary tRNA hydroxylase that acts as a component of the wybutosine biosynthesis pathway. Wybutosine is a hyper modified guanosine with a tricyclic base found at the 3'-position adjacent to the anticodon of eukaryotic phenylalanine tRNA. Catalyzes the hydroxylation of 7-(a-amino-a-carboxypropyl)wyosine (yW-72) into undermodified hydroxywybutosine (OHyW*). OHyW* being further transformed into hydroxywybutosine (OHyW) by LCMT2/TYW4. OHyW is a derivative of wybutosine found in higher eukaryotes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) uses an alternate in-frame splice site and lacks an alternate in-frame exon in the 5' coding region, compared to variant 4. The resulting protein (isoform 1) is shorter than isoform 4.
Write Your Own Review
You're reviewing:Tyw5 (NM_001037742) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG216329 Tyw5 (tGFP-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik) transcript variant 1, (10ug) 10 ug
$500.00
MR216329 Tyw5 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR216329L3 Lenti ORF clone of Tyw5 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 1 10 ug
$600.00
MR216329L4 Lenti ORF clone of Tyw5 (mGFP-tagged) - Mouse RIKEN cDNA 1110034B05 gene (1110034B05Rik), transcript variant 1 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.