Rnf166 (NM_001033142) Mouse Untagged Clone

SKU
MC210783
Rnf166 (untagged) - Mouse ring finger protein 166 (Rnf166), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rnf166
Synonyms 1110031E24Rik; AW555115; Zfp313l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210783 representing NM_001033142
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGATGTTCCGCAGCCTGGTGGCCTCGGCGCAGCAGCGGCAGCCGCCGGCTGGGCCCGCGGGCGGCG
ACAGCGGCCTGGAGGCGCAGTTCAGCTGTCCCATCTGCCTGGAGGTGTACCATCGGCCAGTGGCCATCGG
CAGCTGCGGCCACACGTTCTGCGGGGAGTGCCTCCAGCCATGTCTGCAGGTGCCGTCCCCTCTGTGCCCA
CTCTGCCGTCTGCCCTTCGACCCCAAGAAAGTGGACAAGGCCACCCATGTAGAGAAGCAACTCTCATCCT
ACAAGGCACCCTGTCGGGGTTGCAACAAGAAGGTGACACTGGCCAAGATGAGAGCGCACATTTCCTCCTG
CCTGAAGGTCCAGGAGCAGATGGCTAACTGCCCCAAATTCGTCCCTGTGGTGCCCACATCTCAGCCCATC
CCCAGCAATATCCCCAACCGGTCTACCTTCGCCTGCCCCTACTGCGGAGCCCGCAATCTGGATCAGCAGG
AGCTGGTGAAGCACTGCGTGGAAAGTCACCGCAGTGATCCCAACCGTGTGGTATGCCCCATCTGCTCAGC
AATGCCCTGGGGGGACCCCAGCTACAAAAGCGCCAACTTCCTGCAGCATCTGCTGCACCGGCACAAGTTC
TCCTACGACACCTTCGTGGACTACAGCATCGACGAAGAAGCTGCCTTCCAGGCTGCCCTGGCTCTGTCCC
TCTCTGAGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001033142
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001033142.2, NP_001028314.1
RefSeq Size 1783 bp
RefSeq ORF 714 bp
Locus ID 68718
UniProt ID Q3U9F6
Cytogenetics 8 E1
Summary E3 ubiquitin-protein ligase that promotes the ubiquitination of different substrates. In turn, participates in different biological processes including interferon production or autophagy. Plays a role in the activation of RNA virus-induced interferon-beta production by promoting the ubiquitination of TRAF3 and TRAF6. Plays also a role in the early recruitment of autophagy adapters to bacteria. Mediates 'Lys-29' and 'Lys-33'-linked ubiquitination of SQSTM1 leading to xenophagic targeting of bacteria and inhibition of their replication.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Rnf166 (NM_001033142) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG221146 Rnf166 (tGFP-tagged) - Mouse ring finger protein 166 (Rnf166), (10ug) 10 ug
$500.00
MR221146 Rnf166 (Myc-DDK-tagged) - Mouse ring finger protein 166 (Rnf166) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR221146L3 Lenti ORF clone of Rnf166 (Myc-DDK-tagged) - Mouse ring finger protein 166 (Rnf166) 10 ug
$600.00
MR221146L4 Lenti ORF clone of Rnf166 (mGFP-tagged) - Mouse ring finger protein 166 (Rnf166) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.